Hb bb al расшифровка: UAI, BB, HB, AI — расшифровка сокращений типов питания в отелях

Типы питания в отелях RO, BB, HB, FB, Al, UAI и их расшифровка

Отправляясь в путешествие и бронируя номер в отеле, мы иногда сталкиваемся с аббревиатурами, значения которых не понимаем. Оказывается, загадочные RO, BB, HB, FB, AI, UAI и другие сочетания английских букв, о которых пойдет речь в статье, означают типы питания в отелях и гостиницах. Внимательно читаем дальше – сейчас аббревиатуры раскроют свои тайны и станут понятны всем путешественникам.

Как будут кормить в отеле, если бронировался тип RO

Расшифровка RO говорит о том, что туристам предоставят только комнату для сна и отдыха (room only) и кормить не будут, в связи с чем данный вариант является самым дешевым. Дополнительные обозначения подобных мест проживания, в которых отсутствует питание – AO, EP, BO,OB, NO и RR. Посмотрите – если в буквосочетании присутствует O, то это означает only (перевод с англ. «только») и говорит о том, что еда в цену проживания не входит.

Что ждет заселившихся гостей при оплате проживания BB

Питание по системе BB предусматривает обеспечение путешественников только завтраком и постелью (bed breakfast). Для приема пищи используется шведский стол, где разнообразие обусловливается «звездностью» отеля и государством пребывания. Например, европейский завтрак значительно отличается от подобного варианта в Эмиратах. Бронируя тип BB, вы можете выбрать:

  • континентальный завтрак (CB/CBF)– 3–4 легких блюда, которыми можно перекусить;
  • американский завтрак (AB/ABF)– калорийная и сытная еда, надолго заряжающая энергией.

Как подают еду в отелях HB

Если бронировался номер HB, то проголодавшихся путешественников накормят и утром, и вечером. Аббревиатура расшифровывается как half board и переводится «полупансион«. Некоторые дорогие гостиничные комплексы готовы бесплатно предложить шампанское к утренней еде. Безалкогольные напитки в свободном доступе, а алкоголь необходимо заказывать, оплачивая его сразу же либо оформляя отдельный счет. Существует расширенная вариация – HB+, где гостям бесплатно предлагают здешние спиртные напитки. Обслуживание в отеле осуществляется по системе шведского стола.

Чем накормят гостей, заплативших за вариант питания FB

FB (full board) означает полный пансион – 3-х разовый прием пищи. Для подачи еды используется шведский стол. Роскошные отели способны сделать подарок, предложив с утра шампанское, остальной алкоголь заказывается на вечер и оплачивается отдельным счетом. В варианте FB+ несколько разновидностей здешних алкогольных напитков предоставят даром.

Что означает вид AI

Тип AI говорит о том, что all inclusive – всё включено. Путешественники питаются несколько раз в день. В зависимости от «звездности» гостиницы прием пищи может быть организован как:

  • обычный 3-х разовый;
  • многократный – гриль, бары, рестораны, кафе и т. д.

Местный и (редко) импортный алкоголь предоставляются бесплатно. Импортная алкогольная продукция в отелях высокого класса предлагается даром, в остальных – за отдельную плату. Также встречается упрощенная разновидность сервиса – soft all inclusive, включающая 3-х разовый прием пищи и местные напитки.

Как расшифровать UAI

UAI – это «ультра все включено», по английски ultra all inclusive. Туристы могут питаться столько раз в день, сколько захотят. Кухня отличается многообразием блюд, целый день в открытом доступе сладости и мороженое. Местная и импортная алкогольная и безалкогольная продукция входит в оплаченную стоимость пребывания. Работают ночные бары, грили и т. д. Бронируя UAI, вы получите возможность посетить ресторан, выбрать блюда из меню, где они указаны с ценой, и заказать ужин – по-английски такое обслуживание называется A-la Carte.

Что такое SC

При бронировании номеров SC едой никто не обеспечит, но вы сможете поесть в режиме самообслуживания – так self catering переводится с английского. Поселившимся гостям будет предоставлен доступ к кухне, где самостоятельно можно приготовить собственные блюда.

Зная, какие виды питания скрываются за теперь уже понятными буквосочетаниями, вы легко сможете подобрать место проживания согласно своим предпочтениям

Посмотрите видео про тип питания All inclusive (все включено) в Турции

как расшифровать RO BB HB FB AI UAI?

Привет всем! При планировании отдыха у туристов иногда возникают вопросы: Какая система питания бывает в современных отелях? Что такое шведский стол, континентальный или американский завтрак? Что значит RO BB HB FB AI UAI?

Долгое время я сама путалась, никак не могла запомнить, какими буквами обозначаются завтрак ужин, или трехразовый рацион. Поэтому решила написать коротенький пост, где расшифрую все эти «иероглифы», распишу возможности того или иного варианта.

Современные отели предоставляют гостям разную концепцию питания. Перед вами краткая таблица, более подробно каждый пункт расшифрую ниже.

RO (room only)
RR ОВ EP BO AO NO
без питания
BB (bed breakfast)одноразовое питание — завтраки
HB (half board)двухразовое питание — завтраки ужины или завтраки обеды и безалкогольные напитки во время еды
HB+ (half board plus)двухразовое питание — завтраки ужины безалкогольные и алкогольные напитки местного производства во время еды
FB (full board)трехразовое питание — завтрак обед ужин и безалкогольные напитки во время еды
FB+ (full board plus)
EXTFB (extended half board)
трехразовое питание — завтрак обед ужин, безалкогольные и алкогольные напитки местного производства во время еды
AL (all inclusive)трехразовое питание с промежуточными
перекусами —
завтрак обед ужин, дополнительное питание, все алкогольные и безалкогольные напитки в течение дня
UAL (ultra inclusive)усиленное трехразовое питание с перекусами —
завтрак, обед,
ужин, бесплатное питание в ресторанах A-lacarte, все алкогольные и безалкогольные напитки круглосуточно

Room only (RO) – в переводе обозначает «только комната». Соответственно питание в стоимость не включено.

Bed breakfast (BB) – переводится «кровать и завтрак». Причем завтрак в разных странах или даже отелях может быть, как по системе «шведский стол», так и «континентальный» (СВ), «американский» (АВ) или «английский».

  • СВ (Continental breakfast) – переводится «континентальный завтрак». Все скромно: чашка кофе или чая, тост, булочка, масло и джем.
  • АВ (american breakfast) – от континентального отличается только наличием горячих блюд: омлет, сосиски.

Half board (HB) – на русском языке «полупансион». В некоторых отелях можно выбирать: «завтрак ужин» или «завтрак обед». Кофе, чай, вода, обычно входят в стоимость, но в большинстве отелей получить бесплатно их можно только во время трапезы. В других случаях требуется оплата.

Half board plus (HB+) – «полупансион плюс», отличается от HB только тем, что в стоимость включены некоторые алкогольные напитки. Обычно местного производства и чаще всего только во время еды.

Full board (FB) – переводится «полный пансион». В стоимость входит завтрак обед и ужин, плюс кофе, чай, вода. Условия те же, как и в НВ, только питание трехразовое.

Full board plus (FB), Extended half board (EXTFB) – «полный пансион плюс» или «расширенный пансион», к предыдущей концепции добавляются алкогольные напитки местного производства.

All inclusive (AI) – в переводе обозначает «все включено». Название полностью оправдывает себя. Сюда входит завтрак, обед, ужин, промежуточное питание: поздний завтрак, полдник, поздний ужин, другие перекусы. Безалкогольные и алкогольные напитки в неограниченном количестве в течение всего дня. Как правило, эта система питания подразумевает возможность поесть с 6 утра до 12 ночи.

Ultra inclusive (UAL) – «ультра все включено». Завтрак, обед, ужин, с возможностью бесплатно посещать рестораны A-lacarte (тематические рестораны на территории отеля). Такая концепция включает в себя больший выбор и большее разнообразие в питании, чем AI. Разумеется, любые напитки входят в стоимость.

Регламент питания в отелях может быть разным. Чаще всего, особенно в курортных зонах, распространена концепция питания «шведский стол». Шведский стол – это возможность самостоятельно выбрать и скомпоновать себе рацион. При такой системе блюда расставляются в зале, а туристы сами выбирают и накладывают еду в тарелку.

В России пока мало где перешли на систему «шведский стол». Во многих гостиницах и санаториях еще работает система заказного меню. Причем в санаториях чаще всего выбор блюд происходит заблаговременно (за 2-3 дня), как правило, предлагается список всего из ¾ блюд по заранее установленному перечню.

В заключении, хочу вам сказать, что в разных странах, и даже в разных отелях одной страны, реальный перечень услуг по той или иной системе питания может разительно отличаться. Например в Крыму AL — это скорее FB+, иногда даже без плюса. Об особенностях концепции «все включено» в Крыму, я написала отдельную статью, можете посмотреть здесь.

Если вы сейчас выбираете место отдыха возможно вас заинтересуют материалы:

Есть интересные статьи по подготовке к путешествию:

Обратите внимание на рубрику «Путешествия читателей». Как опубликовать там свой рассказ, читайте здесь.

Подписывайтесь на обновления блога, я регулярно выкладываю новую информацию, всегда будете в курсе выхода свежих статей. Делитесь материалами в социальных сетях, оставляйте комментарии, всегда рада активным читателям.
На этом прощаюсь, приятного вам отдыха!
Татьяна Соломатина

Этой статьёй стоит поделиться с друзьями. Жми!

Твитнуть

Поделиться

Поделиться

Класснуть

Расшифровка типов питания в отелях.

RO (Room only) – без питания.

BB (Bed & Breakfast) – только завтрак (шведский стол), бесплатные напитки: чай, кофе, вода.

HB (Half Board) – полупансион — завтрак и ужин (шведский стол), бесплатные напитки: чай, кофе, вода на завтрак. Напитки в обед и ужин — платно.

HB+ (Half Board Plus) – полупансион — завтрак и ужин (шведский стол). Плюс алкогольные и безалкогольные напитки местного производства во время приема пищи.

HBS (Half Board Superior) – полупансион высшего качества: шампанское при заселении, завтрак, поздний завтрак (шведский стол, свежевыжатый сок, чай, кофе), ужин (шведский стол в основном ресторане или ресторане «a la carte» с предоставлением алкогольных и безалкогольных напитков местного производства в ограниченном количестве), поздний ужин.

FB (Full Board) – завтрак, обед, ужин (шведский стол). Напитки в обед и ужин — платно.

FB+ (Full Board Plus) = EXTFB (Extended Full Board) – завтрак, обед, ужин (шведский стол). Плюс напитки (в ряде отелей пиво и вино) во время приема пищи.

Al (All inclusive) – все включено: завтрак, обед, ужин (шведский стол), алкогольные и безалкогольные напитки местного производства без ограничения. В большинстве отелей сауна и турецкая баня.

UAI (Ultra All Inclusive) = SAI (Superior All Inclusive) = EXTAI (Extended All Inclusive) = ELGAI (Elegance All Inclusive) = VIPAI (VIP All Inclusive) – ультра все включено: завтрак, обед, ужин (шведский стол), алкогольные и безалкогольные напитки местного и импортного производства без ограничения. Плюс дополнительные услуги в отеле по усмотрению администрации (например сауна, турецкая баня, бильярд, тенис …).

HCAI (High Class All Inclusive) = DAI – (Deluxe All Inclusive) – Все бесплатно, кроме: магазинов, телефона, врача, парикмахерской, некоторых водных видов спорта и подводного плавания.

Continental Breakfast, Континентальный завтрак — легкий завтрак, состоящий из кофе или чая, сока, булочки, масла и джема.

Английский завтрак — полный завтрак, обычно включает сок, яичницу, тосты, масло, джем и кофе(чай).

Американский завтрак — аналогичен континентальному завтраку, включает различные нарезки и горячие блюда.

Обратите внимание:

— Всю информацию связанную с напитками и прочими дополнительными услугами получите по прибытии в гостиницу. Обязательно поинтересуйтесь.

— По системе AI, UAI, AI luxe все напитки подаются в стаканах. Если вздумается взять с собой, например, бутылочку вина — придётся заплатить.

— A la carte меню, в котором каждое блюдо указано со своей отдельной ценой, обслуживание официантом.

Категория питания fb. RO BB HB FB AI UAI — расшифровка типов питания в отелях

Особенно если вы уезжаете в далекие заморские страны, где не особо хочется питаться в местных забегаловках. Любая поездка, деловая, туристическая или оздоровительная, подразумевает выбор комфортабельного отеля. Чтобы у вас не возникал вопрос о том, питание НВ — что это такое, предлагаем разобраться с системой подробнее.

Все знаменитые и не очень отели имеют специальные обозначения номеров и питания. Вы собрались отдыхать в незнакомой стране, выбираете по звездам гостиницу и тут натыкаетесь на странную аббревиатуру возле графы «Питание»: НВ. вопрос задают тысячи туристов, впервые выбирающих тур.

Виды питания

Чаще всего они указываются на английском (международном) языке или в сокращенном варианте. Все отели подстраиваются под общепринятые стандарты, так что заранее заучите аббревиатуры, и вы сможете в них ориентироваться как заядлый путешественник, а что значит питание НВ, ВВ, будете рассказывать новичкам, желающим поехать в ту или иную гостиницу.

BB, или Bed & Breakfast

По сути, переводится это как «кровать и завтрак». Понятно, что вам будет предоставлен только утренний прием пищи, который изначально был включен в стоимость тура. За остальные вы должны вносить дополнительную плату в ресторане. Как правило, предлагается шведский стол. Это подразумевает, что вы сами подходите к большому накрытому столу, на котором разложены блюда, и накладываете их в нужном вам количестве.

Тип питания, где подразумевается только утренний прием пищи и ночлег, чаще всего встречается в европейских небольших гостиницах и маленьких курортных городках, а еще в тех местах, где основной упор делается на экскурсионный туризм. Это удобно, если экскурсионная программа расписана на весь день, то есть вы рано выезжаете из отеля и возвращаетесь только поздно вечером.

Что предлагают на завтрак

Питание в отеле НВ более полноценно, но если вы хотите сэкономить, рассмотрим подробнее меню BB. Это самые различные бутерброды, тушеные и жареные овощи закуски на тарталетках и пресных хлебцах, бутерброды-канапе, обжаренные кусочки мяса или куриные крылышки, различные салаты и десерты. Также чай, вода или кофе относятся к бесплатным напиткам. Алкоголь, коктейли и соки придется покупать за свои деньги. Питание НВ — что это? Об этом вы прочитаете дальше.

HB (Half Board), FB и AL

Если вам не нравится идея одного лишь завтрака, и вы хотите питаться два раза в день, тогда стоит остановиться на системе под названием «Питание НВ». «Что это?» — спросите вы. Аббревиатура переводится как «полупансион». Бесплатно вы питаетесь дважды. Чаще всего сюда входят только завтрак и ужин. В других гостиницах могут предложить завтрак и обед, хотя это не особо приветствуется. Заменить ужин обедом предлагают отели ОАЭ.

Только в утренние часы напитки предлагаются бесплатно. Обычно это кофе, чай и вода. За напитки в обед или ужин придется заплатить. Если бутылка спиртного осталась вами недопита, ее подают на следующий день в вечерний прием пищи. Что еще удобно при выборе системы HB? Вам не придется вносить оплату каждый раз за напитки. Все просто — вы говорите официанту номер комнаты проживания, и счет предоставляется после выселения из отеля.

Кому понравится HB? Чаще всего такой тип питания встречается в гостиницах 3* или 4*. Это идеально для путешественников, которые приехали отдохнуть ненадолго, а также понравится тем, кто в обед предпочитает сходить в ресторан. Если вы весь день проводите на пляже и наслаждаетесь солнечными ваннами, выбирайте отель с питанием по типу HB. В обед вы сможете перекусить чем-либо на пляже, да и в полуденные часы сильно есть не хочется. Легкий салатик днем или закуски, бокал пива местного разлива помогут сэкономить деньги и поберечь фигуру, ведь обычно на обед подаются более плотные и сытные блюда.

FB, AL — это Full Board и Что означает НВ питание и ВВ, мы уже разобрались. Full Board — это в который входит полноценная трехразовая подача пищи (завтрак, обед и ужин). Не включаются в стоимость напитки, которые выставляются на обед или вечером на ужин.

«Все включено» имеет тот же принцип питания, что и полный пансион. То есть завтрак, обед и ужин вам дают от отеля бесплатно. Дополнительно к ним подаются алкогольные и безалкогольные напитки, в основном от местного производителя. Что значит питание НВ, ВВ и AL, известно, и вы можете выбирать место проживания. Но есть еще одна категория, более элитная — UAL.

UAL или Ultra All Inclusive

Переводится как «ультра все включено». Сюда также включаются завтрак, обед и ужин. К алкогольным и безалкогольным напиткам местного производства подают еще импортные. Могут предоставляться различные бесплатные услуги на усмотрение администрации.

Английский и континентальный завтрак

После того как мы разобрались с тем, что значит питание ВВ, НВ, AL и UAL, перейдем к традиционным завтракам. В некоторых отелях туристу могут предложить английский, американский или континентальный.

1. Английский завтрак.
Выполнен в старинных традициях Англии. Полный набор блюд включает в себя сок (апельсиновый или любой другой фруктовый), яичницу с добавлением ломтиков ветчины (в некоторых отелях вместо нее полагается омлет), поджаренные до хрустящей корочки ароматные тосты. К ним выставляют сливочное масло и фруктовый джем. Из напитков, конечно же, чай или кофе.

2. Континентальный завтрак.
Более прост и скромен, чем английский. Подают сдобную булочку с маслом или джемом к кофе, соку или чаю.

3.
К столу подносят различные виды колбас и сыров (нарезки), горячие сосиски, а также омлет, кофе, чай, воду или сок.

«Здоровое питание» немаловажная (а для многих и важнейшая) составляющая удачного отдыха. Увы, никаких нормативов, позволяющих быть уверенным, что в выбранном вами отелей нас будут кормить «до отвала», вкусно и разнообразно, не существует. Разумеется, любой турист сегодня в курсе, что из турецких отелей большинство уезжает заметно поправившись, а вот французы вам такую возможность вряд ли предоставят. Хотя, в любом случае выбор блюд в отеле 5* будет заведомо выше чем в 3*.

Чаще всего виды питания в отелях обозначаются латинскими буквами (BB, HB, FB) — такие сокращения можно обнаружить и в описании тура, и в каталоге, где представленны собственно отели.

Питание ВВ (Bed&Breakfast)

ВВ означает, что в отеле вы получите только завтрак. Обычно, такой вариант предлагается для экескурсионных туров или бизнес-поездок. Континентальный завтрак (обычно именно такой подается в отелях 2*-3*) чаще всего небогат какая-нибудь тонко нарезанная колбаса и сыр, рогалик с джемом, маленькая упаковка йогурта, кофе. Если это «шведский стол» (во всем мире известный как «буфет»), то к ним добавляются овощные и фруктовые салаты, несколько видов выпечки, вареные яйца. В отелях высокого уровня можно уже рассчитывать на горячие блюда сосиски и омлет. Обязателен за завтраком и сок, который обычно наливается из автомата, однако почти наверняка он оказывается сильно разведенным концентратом.

Важно заметить, что в гостинице любого уровня завтрак входит в стоимость проживания и отказаться от него невозможно. Обычно завтрак накрывается не позднее 7 утра, но если вы выезжаете в аэропорт или на экскурсию раньше, вам нужно предупредить портье — вам накроют завтрак пораньше (правда, без горячего блюда) или дадут с собой ланч-пакет.

Питание НВ (Нalf-Board)

HB — полупансион, то есть завтрак и ужин наиболее популярный вид питания практически на всех курортах, за исключением Турции, любящей «включать все». Завтрак в этом случае обычно традиционный «шведский стол», ужин может быть и «шведским столом» и салат-баром с некоторым выбором горячих блюд согласно меню. Любые напитки в этом случае платные (это относится и к простой воде, если ее приносят не в кувшине, а в стеклянных бутылках) и стоят недешево. Правда, если вы заказываете за ужином бутылку вина и не выпиваете ее целиком, то ее вам оставят на следующие дни. Каждый раз расплачиваться за напитки не нужно вы лишь назывете номер комнаты официанту, а при отъезде получаете от портье счет за все дни (который рекомендуем тщательно проверить!).

Особенно дороги вечерние спиртные напитки в отелях Египта. К тому же их качество сомнительно, так что лучше ограничиться за ужином прохладительными напитками (только без льда здесь его делают из местной некипяченой воды!), а более крепкие напитки приобрести, например, в хургадском варианте приснопамятной валютной «Березки», которая здесь называется «Пирамида».

Питание FB (Full-Board)

FB это полный пансион, который в нашем детстве именовался «трехразовым питанием». Обед, как и ужин, в этом случае может быть и «шведским столом» и обслуживнием по меню, но в любом случае напитки днем и вечером вновь оплачиваются отдельно. При возможности выбрать между «полупансионом» и «пансионом» туристы обычно выбирают первое, поскольку в Испании, Греции или на Кипре найти даже в разгар сезона неплохую таверну рядом с отелем не проблема. К сожалению, заменить гостиничный обед на ужин или наоборот можно далеко не во всех отелях, хотя гостиницы ОАЭ подобную услугу оказывают.

Систама AL (All Inclusive)

All Inclusive «все включено» — любимое российское развлечение на турецких курортах, в других странах распространенное намного реже. В недорогих отелях 2*-3* предполагает обычное трехразовое питание со стандартным выбором блюд (скажем, вечером это 2-3 вида супа, 3 вида второго) и 1-2 бара, бесплатно «отпускающие» в течение дня чай-кофе, минеральную воду, колу и местные спиртные напитки.

Набор местного спиртного везде одинаков это виноградная водка ракия (по-турецки «ракы»), которую пьют, разбавляя водой, в результате чего она приобретает молочный цвет, местный коньяк (кonjak), напиток под странным названием VoTka, красное сухое вино в принципе, неплохое, но без «изысков» и, разумеется национальная гордость пиво «Эфес». Конечно, в этих отелях можно заказать и импортное спиртное но уже за дополнительную плату.

Все остальные виды All Inclusive, предлагаемые турецкими отелями под названием «Ультра», «Максимум», «Империал» и т.д. представляют практически круглосуточное питание (и выпивание в том числе и импортного спиртного). Оказавшиеся в турецком «клубном» отеле туристы могут в течение дня посетить последовательно два завтрака, обед, «чайный» полдник, ужин и «поздний суп» после дискотеки, а в перерывах лакомиться сендвичами, пиццей, мороженым и сладостями.

Разнообразие и выбор блюд здесь частно превышают разумные пределы, качество отличное тем более что в лучших отелях многие блюда готовятся непосредственно при тебе. При желании, можно забронировать заранее столик и провести вечер не за общим «шведским» столом, а в итальянском или японском ресторанчике, расположенном на территории отеля. Что же касается импортного спиртного, то обычно его выбор ограничен несколькими сортами виски, мартини, джина. Однако, часто и в таком отеле предупреждают, что несколько видов элитного спиртного (дорогие коньяки, вина) предлагаются за дополнительную плату. Кстати, часто в отелях, работающих по системе «все включено» просят назвать номер комнаты и раписаться на чеке даже при заказе «бесплатного» спиртного. Опасаться этого не следует просто это одна из форм контроля работы официантов.

Ольга Степанова

Время на чтение: 5 минут

А
А

При выборе отеля немалую роль играет вид предоставляемого питания, которое, как правило, выглядит замысловатым буквенным шифром. Чтобы не ошибиться и исключить дополнительные затраты, нужно заранее уточнить – какой именно тип питания будет ждать вас в отеле.

  • Такой код питания, как ОВ, RO, NA, AO или ЕР

    , говорит о том, что питание не предусмотрено.
  • СВ

    – только завтрак (булочка с маслом/джемом, чай/кофе, сок, иногда йогурт).

  • АВ

    – американский завтрак. Он состоит из горячего блюда (например, сосиски с омлетом) и нарезок сыра/колбасы.
  • Английский завтрак

    предполагает соки/минералку, чай/кофе, тосты с маслом/джемом и яичницу с ветчиной.
  • Шифр ВВ

    означает, что вам положен исключительно завтрак, а именно – шведский стол в ресторане отеля. Что касается напитков – за них придется заплатить. Обед с ужином тоже в стоимость не входят – в барах/ресторанах отеля за ваши деньги.
  • ВТ

    – вам положен завтрак и лечение.
  • ВВ+

    предполагает чуть более расширенный вариант ВВ. Помимо шведского стола с утра, вы можете рассчитывать и на дополнительные услуги. Какие именно – лучше узнать заранее.
  • BL

    – только завтрак с обедом. Напитки бесплатно – только к завтраку и без алкоголя.
  • НВ

    – завтракать и ужинать вы сможете в ресторане отеля (шведский стол). К завтраку совершенно безвозмездно – вода, чай, кофе. А вот за обед придется раскошелиться.
  • НВ+

    — тот же вариант, что в предыдущем пункте, но можно еще рассчитывать на безалкогольные/алкогольные напитки в течение всего дня.
  • FB

    – за напитки придется платить, а вот питание в главном ресторане, как полагается – завтрак, обед, ужин (конечно, шведский стол).

  • FB+

    — шведский стол трижды в день и предлагаемые в отеле напитки к нему (вино, пиво – в зависимости от правил).
  • АР

    – полный пансион. Можете не волноваться – завтрак, обед и ужин точно будут.
  • BP

    – весьма плотный американский завтрак, и на этом все.
  • CP

    – легкий завтрак, остальное – за отдельную плату.
  • MAP

    – для вас только завтрак и обед, ужин – только за свой счет (в общую стоимость не входит), в отдельных отелях может быть включено послеполуденное чаепитие.
  • LIGHT ALL INCLUSIVE

    – можете рассчитывать на завтрак, обед, ужин. Напитки для вас – в неограниченном количестве. То есть, минералки, алкоголя, соков и пр. можно пить, сколько душа пожелает. Кроме того, отель порадует еще и дополнительным питанием (в соответствии со своей «звездностью») – полдником, барбекю, поздним ужином или просто легким «перекусом».
  • ALL INCLUSIVE

    – вас ждет два завтрака (основной + поздний), любые местные напитки в течение дня, а также шведский стол в обед и ужин.
  • ULTRA ALL INCLUSIVE

    – шведский стол трижды в день в основном ресторане, местные напитки с алкоголем и без, а также отдельные импортные напитки. Иногда отели предлагают еще массаж или теннис в качестве дополнительной услуги.

  • HCAL

    – платить отдельно ни за что не придется. Все к вашим услугам, в пределах разумного.
  • CLUB PHARAOH

    – трижды в день – шведский стол + любые местные напитки. При заселении в отель – приветственный «продуктовый набор»: коктейль, вино с фруктами и кондитерские изделия. В номере вас будут обязательно ждать тапочки и халат. Также вы можете рассчитывать на полчаса бесплатного массажа и интернета. Поиграть в большой теннис тоже можно безвозмездно.
  • ULTRA ALL INCLUSIVE I Wish

    – вас ждет трехразовый шведский стол, подарочная бутылка вина в день приезда, любые местные напитки – без ограничения. А также джакузи + сауна (не более 2-х часов), и к ним – импортные виски, ром, мартини, кампари.
  • А-la carte

    означает, что вы сможете выбрать любое блюдо из тех, что предложены в меню ресторана.
  • DNR

    – только ужин. Как правило, в виде шведского стола. Что касается Европы – выбор вторых блюд будет ограничен количеством 3-5, зато салаты и закуски можно есть, сколько захочется.

И помните, что смысл заветной фразы «все включено» отличается от фразы «полный пансион». Второй вариант чаще всего не предполагает бесплатных напитков

. А выбирая между полупансионом и полным пансионом, ориентируйтесь на то, сколько времени вы собираетесь тратить на отдых в отеле. Потому что полный пансион избавит вас от необходимости тратиться на питание

в городских ресторанах.

Правильное и здоровое питание для многих туристов является одним из самых наиважнейших и основополагающих вопросов хорошего и полноценного отдыха. На сегодняшний день никаких нормативных систем или стандартов, которые бы позволяли быть уверенными, что в выбранном отеле будет здоровый, правильный и разнообразный стол не существует.

Естественно, любой отдыхающий сегодня знает, что в турецких отелях кормят очень хорошо и после окончания путевки, домой вы приедете на несколько килограмм тяжелее. А вот французские отели вам такого питания не предоставят. Но в любом случае кормить в 5* отеле будут намного лучше, чем в 3*. Так как тип питания во всех мировых отелях обозначается латинскими буквами, давайте посмотрим, что означает аббревиатура FB.

Тип питания FB

Питание fb, что это значит, что в него входит и как расшифровывается данная латинская аббревиатура? Система питания FB (полная расшифровка full board на русском языке означает «полный пансион»)
представляет собой шведский стол, который предлагается гостям на завтрак, обед и ужин. В то же время система питания типа FB+ является полным пансионом с завтраком, обедом и ужином (шведский стол), а также различные бесплатные спиртные напитки обычно собственного местного производства, которые подаются во время трехразового приема пищи.

В некоторых дорогих отелях при системе FB гостям подают бесплатное шампанское на завтрак.

Поэтому, если вы видите обозначение ФБ, то это значит, что вы можете быть уверенными в том, что вам не придется думать о своем рационе питания, так как три раза в день вы сможете выбирать для себя самые различные блюда со шведского стола и кушать столько сколько захотите. Порции здесь не ограничены. В этом есть свои существенные и очень весомые преимущества, так как не каждый человек сможет полностью утолить голод, представленными «взвешенными» блюдами определенного веса в граммах.

Но между тем обед, также как и ужин может быть представлен как шведским столом, так и обычным обслуживанием официантами по представленному меню. Но при системе FB все напитки, которые гости заказывают днем и вечером они должны оплачивать отдельно
. Данный вид питания подходит практически всем туристам, а особенно семейным парам с маленькими детьми, которые иногда очень привередливы в выборе еды.

Также хочется отметить, что если есть возможность выбрать между полупансионом и пансионом, то обычно отдыхающие выбирают первый вариант, так как в таких странах как Испания, Греция и на острове Кипр можно легко найти подходящую недорогую таверну рядом с отелем или гостиницей и неплохо пообедать.

Заменить обед в гостинице на ужин или наоборот можно не в каждом отеле курорта, но гостиницы Объединенных Арабских Эмиратов такую услугу своим гостям оказывают.

Что такое шведский стол в отелях?

Шведский стол как таковой представляет собой систему самообслуживания, когда в зале расположено несколько больших столов или специальных закрытых лотков с различными видами блюд: салатами, гарнирами, мясом, рыбой, десертами, фруктами. Гости проходят мимо столов и выбирают понравившиеся блюда, которые кладут себе в тарелку в неограниченном количестве.

В дорогих отелях могут быть рестораны типа А ля Карт (тематические или делящиеся по кухням мира)
. Здесь клиент выбирает понравившиеся ему блюда, а официант их затем приносит. В зависимости от системы питания такие рестораны могут быть как платными, так и бесплатными. Если ресторан А ля Карт платный, а у вас тип питания FB, то вы сможете там поужинать с хорошей скидкой и в счет ужина по типу «шведский стол». Также необходимо помнить, что заказать ужин в таком ресторане отеля гости могут только по предварительной записи и желательно за несколько дней до планируемого мероприятия.

Любой путешественник отправляясь в дорогу вынужден задумываться о «хлебе насущном», или проще говоря о том, как, где и чем он будет восполнять свой «энергетический запас».

Подбирая отель для отдыха, необходимо сравнивать возможные варианты не только по цене, но и еще по набору услуг, который за указанную цену предлагается (что собственно и определяет звездность отеля) и по типу питания
.

На отдыхе можно питаться самостоятельно или воспользоваться питанием в ресторане выбранного отеля. Бронируя отель (тур с проживанием в отеле) необходимо определиться с режимом размещения, т.е. с типом питания.

Какие бывают варианты режимов питания? Какое питание предпочесть?

В результатах поиска варианты питания в отелях определяются стандартными аббревиатурами (BB/ HB/FB/AI/UAI и пр.). Не каждый турист знаком с их расшифровкой.

Перед тем, как привести расшифровку типов питания, обращаем ваше внимание, что тип питания
определяет не ассортимент блюд в отеле, а лишь режим работы ресторанов/баров отеля. Выбор блюд на «шведском столе» зависит в первую очередь от категории отеля (чем больше звезд, тем более разнообразнным обязано быть питание), и во вторую от цены отеля. Не стоит ждать от отеля 5* с ценой проживания аналогичной 3* разнообразия на «шведском столе»….

Типы питания (аббревиатуры, расшифровка и пояснения):

AO
(accomodation only) — размещение без питания или в других поисковых системах можно встретить аналог RO (room only)

Вариант AO предлагается в большинстве случаев при размещении в апартаментах, а также в последнее время и при размещении в отелях. Вариант размещения в апартаментах без питания часто выбирают туристы, которые нуждаются в специальной диете или путешествующие с детьми, когда родители предпочитают готовить для детишек самостоятельно. Размещение в отелях без питания удобно, в случае его расположения на курорте с множеством ресторанчиков и баров.

CB
(continental breakfast)
континентальный завтрак

Континентальный завтрак это скромный и весьма определенный набор на каждого человека (чай/кофе + круассан/булочка + масло/джем), который предлагает туристам в основном городские отели. Расширенный вариант континентального завтрака CB+ обычно предполагает добавление к стандартному набору еще и йогурта.

BB
(breakfast buffet) — завтрак

Завтрак-буфет предполагает возможность выбора туристом продуктов из предложенного ассортимента. Иными словами буфет — это шведский стол (понятие более знакомое нашим туристам). Разнообразие ассортимента на шведском столе зависит, как указывалось выше, от категории отеля и цены, ну и конечно, специфики региона, где отель расположен.

HB
(half board)
полупансион

Полупансион — двухразовое питание и в большинстве отелей мира подразумевает под собой завтрак и ужин. Завтрак, как правило, предоставляется по типу «шведский стол», а ужин может быть как по типу «шведского стола», так и по меню (гостям предлагается буфет с салатами/закусками и горячие блюда на выбор из меню).

Во время завтрака гостям отеля предлагаются напитки — чай, кофе и др. Во время ужина все напитки в режиме питание HB предлагаются только за отдельную плату.

В последнее время многие отели предлагают расширенный питания — HB+
, что подразумевает наличие напитков на ужине (вода/вино, но в ограниченном количестве, например 0,5 л воды + 0,5 л столового вина)

Полезно знать, что если отель, в котором Вы размещаетесь, работает также и по режиму FB (полный пансион — т.е ресторан отеля функционирует и в обеденное время), то обычно у гостей есть возможность менять ужин на обед, что очень полезно при выезде на вечерние экскурсии.

Часто туристы задают вопрос можно ли забронировать размещение в отеле только с ужином/обедом, аза завтрак не платить? Ответ — нет, отказаться от завтрака можно только заказав размещение без питания вообще. оставить одни ужины без завтраков невозможно.

FB
(full board)
полный пансион

Полный пансион — трехразовое питание (завтрак + обед + ужин). напитки на обеде и ужине предлагаются гостям отеля за отдельную плату (даже вода!). В зависимости от отеля (необходимо уточнять в описании) ужин может предлагаться по типу «шведский стол» или по меню.

FB+
— расширенный вариант питания FB c включением напитков (вода/вино местного производства в ограниченном количестве на каждого человека)

AI
(all inclusive)
все включено

Система «все включено» — режим размещения, при котором туристу предлагается трехразовое питание, неограниченное количество напитков местного производства, как правило, в течении всего дня, но, может быть и ограничение, например, с 10:00 до 23:00 (с концепцией можно ознакомится в описании конкретного отеля), а также некоторый набор услуг в отеле (например — бесплатные лежаки, посещение тренажерного зала и т.д.).

Стоит отметить, что неограниченное количество напитков не означает их выдачу в закупоренных бутылках. Как правило, напитки предлагаются на розлив.

UAI
(ultra all inclusive) / EUAI (excellent) / SUAI (super) / DUAI (diamond) и т.д.
разновидности расширенного режима «все включено».

При «Ульра все включено» и прочих разновидностях каждый отель добавляет в систему «все влючено» напитки импортного производства и различный набор бесплатных услуг (например, использование сейфа, посещение тренажерного зала, сеансы массажа и т.п.), которым старается отличится от других отелей. Перечень услуг, входящих в концепцию «все включено» для каждого конкретного отеля указывается в описании отеля и может изменяться от сезона к сезону.

Каждый турист должен понимать, что ничего бесплатного нет — просто перечисленные бесплатные услуги уже включены в стоимость
и, чем более расширенная система all inclusive в отеле, тем дороже суточная стоимость проживания в этом отеле.

На данные момент система «ультра все включено» достигла некоторого своего пика и многие отели напротив стали в угоду европейскому туристу отходить от максимального включения всех услуг в изначальную стоимость, так как в реальности турист платя за них не имеет физически время ими воспользоваться. Европейцы, особенно из стран северной Европы, предпочитают платить лишь за то, чем реально пользуются.

Какое питание предпочесть?

Итак, с аббревиатурами разобрались остаётся вопрос, что предпочесть в конкретной стране. Конечно, каждый турист знает свой аппетит, но позволим себе дать общие рекомендации.

Туристы в своих предпочтениях по режиму питания обычно делятся на 3 группы:

  • Первая группа
    — это туристы, которые начали осваивать заграничный отдых с Анталийского побережья Турции и воспитавшись на различных super all inclusive интересуются отелями исключительно с данной системой питания и другого себе просто на мыслят, как их не переубеждай.
  • Вторая группа
    — это туристы, вкусившие все прелести самостоятельного питания на европейских курортах и разыскивающие отели с минимальным питанием на любых курортах, независимо от бюджета
  • Третья группа
    — это туристы, относящиеся к выбору питания по экономическому принципу: платить надо лишь за то, чем будем пользоваться.

Где хорош all inclusive?

В странах и регионах, где туристу просто-напросто выйти некуда за пределы отеля, чтобы поесть. Например, Анталийское побережье Турции — это изначально пустынные участки земли, на которых воздвигнуты шикарные отели. Как привлечь туриста в отель, если он стоит в пустынной местности? Ответ прост — сделать для туриста все на территории отеля — и развлечения, и круглосуточное питание, чтобы у туриста и мысли не возникало выходить за территорию отеля. На этом же принципе работают отели в таких странах как, например, Куба, Доминикана, Мексика, о.Маврикий, Мальдивы и др.

Имеет ли смысл all inclusive в Европе?

Все зависит от расположения отеля и от Вашего бюджета. Надо понимать, что «all inclusive» в Турции и Доминикане сильно отличается от «all inclusivе» в Испании или Греции. В частности европейские отели редко обладают такими же большими территориями и собственными пляжами. Т.е. утрировано — «захотели пить — возвращайтесь из пляжа в отель…», а это порой не близко. К тому же на большинстве европейских курортах есть куда выйти и где поесть.

Питаться в отдельных ресторанчиках намного интересней, чем на «шведском столе» в отеле. Здесь уже возникает вопрос о бюджете. Если Вы более-менее свободны в деньгах, то выбирайте минимальное питание. Если же бюджет ограничен и Вы не относите себя к категории гурманов имеет смысл бронировать отель с максимальным питанием, так как это будет экономичнее, даже в том случае, если часть питания в отеле Вы и пропустите ради экскурсий или дегустацией местной кухни в стильном ресторанчике на курорте.

Сколько раз должны кормить и какое питание при заезде в отель первое по счету?

Заграничные отели реализуют проживание ночами. Если Вы бронируете тур с завтраком/ полупансионом/полным пансионом, то отель должен Вам предоставить столько завтраков/ завтраков+ужинов/завтраков+обедов+ужинов за сколько ночей Вы заплатили, т.е. предоставить вам возможность посетить свой ресторан определенное кол-во раз. Но рестораны работают в определенное время и если же в силу времени Вашего заезда/выезда или отсутствия в силу экскурсионной программы Вы не попадаете в ресторан в период его работы — отель не обязан это чем-либо компенсировать. Хотя большинство отелей категории не ниже 3* (но не все!) могут предоставить Вам «холодный ужин» в случае позднего прибытия в отель (если Вы отель заблаговременно предупредите) и завтрак «сухим пайком» в случае раннего выезда из отеля (также надо заказывать данную услугу заранее).

Заезд в отель обычно не раньше 14.00 и первым питанием для туристов может быть либо обед (при заказе полного пансиона), либо ужин (при заказе полупансиона). Первый завтрак будет предоставлен только на следующий день после заезда, а последний в день выезда.

Также напомним о возможности замены ужина на обед, о чем упоминалось при описании режима «полупансион».

Система питания ro bb hb. Питание в отелях расшифровка

При выборе тура и отеля каждый старается найти для себя идеальный вариант в зависимости от наличия определенной суммы средств. И для многих очень важен вопрос питания, так как кому-то лучше, когда предлагается вариант проживания, включающий в себя и завтрак, и обед, и ужин, а для кого-то идеальным и вполне достаточным вариантом является наличие только утреннего приема, и переплачивать за остальные варианты питания не хочется. Есть разные виды питания в отелях, расшифровка которых приведена в статье
. С ними важно ознакомиться, так как обозначаются они далеко не понятными нам фразами, а определенными аббревиатурами.

Какие виды питания существуют?

Вопрос питания в любом отеле – один из важнейших при выборе места проживания в той или иной стране. Здесь многое зависит от желаемого вида отдыха, а также от возраста покупающего путевку человека. Например, студентам порой достаточно взять отель, вообще не предоставляющий питание, а вот людям пожилым обычно предпочтительнее выбрать тот, где есть и завтраки, и обеды, и ужины. И в каждом отеле есть своя система питания, которая может зависеть от звездности или ряда иных аспектов.

При бронировании путевки можно увидеть, что на сайтах никогда не пишется конкретно, сколько приемов пищи предлагается в том или ином отеле. Обычно они обозначаются определенными аббревиатурами. И если эти обозначения понятны заядлым и опытным путешественникам, то новичкам они кажутся «филькиной грамотой». Чтобы правильно выбрать наиболее подходящий для себя вариант, стоит научиться разбираться в этих обозначениях.

Основные варианты обозначений

Итак, рассмотрим подробнее основные варианты обозначений типов питания. К ним относятся аббревиатуры ВВ, НВ, FB и AL.

  • ВВ
    – расшифровывается как Bed and Breakfast. Это обозначение гласит, что те, кто будет проживать в отеле, смогут получать лишь завтрак, который обычно представлен в виде шведского стола, где каждый желающий сможет выбрать наиболее подходящее ему по вкусу блюдо. Обычно такое питание включает в себя салаты, выпечку, различные напитки типа соков и чая, какие-то горячие блюда типа жареного яйца и т. д. За все остальные приемы пищи придется платить отдельно. Либо можно обедать и ужинать вне стен отеля;

На заметку!
Такой вариант как ВВ отлично подойдет тем, кто предпочитает не засиживаться в номерах, а посещать экскурсии и всячески активно проводить свободное время. Удобнее и выгоднее всего в этом случае перекусить где-нибудь по дороге.

  • НВ
    – полное наименование Half Board. В этом случае человек, проживающий в отеле, будет не только завтракать, но и ужинать, но не получит обеда. Завтрак обычно представлен в виде шведского стола, аналогичного варианту ВВ. Ужин может быть в таком же формате, либо это может быть салат-бар, когда человек выбирает тот или иной набор горячих блюд. Напитки могут как входить в такой ужин, так и приобретаться за отдельную стоимость. Обычно бесплатное питье включено только в завтрак. Чаще всего вариант НВ встречается в отелях в Европе;
  • FB
    – Full Board. Этот вариант включает три приема еды – завтрак, обед и ужин. Первый прием идет в формате шведского стола, а вот в обед и вечером нужно будет выбирать блюда согласно меню. Напитки обычно приобретаются отдельно;
  • AL
    – это обозначение «Все включено» или All Inclusive. Оно, в свою очередь, может подразумевать несколько вариантов. Например, это может быть трехразовое питание, а также возможность пить любые напитки в течение всего дня. Как правило, такой вариант можно встретить в отелях Турции или Египта.

Другие обозначения вариантов питания

Помимо основных видов питания, есть и другие, которые могут кардинально отличаться от описанных выше или же быть одним из их вариантов. Рассмотрим и другие обозначения, которые могут встретиться пользователю при бронировании отеля.

Таблица. Другие варианты питания.

ОбозначениеХарактеристика
Аббревиатура расшифровывается как Ultra All Inclusive. Данный вариант предполагает, что проживающие в отеле гости могут есть и пить, что им угодно, в любое время дня. Да и выбор пищи и напитков будет больше, чем в стандартном варианте «Все включено». Также проживающим будут предлагаться алкогольные напитки, притом – обычно недешевые. Часто этот вариант встречается в отелях Египта или Турции.
Этот вариант встречается тоже часто в некоторых странах. Предполагает «все включено», но можно в течение дня еще и брать различные напитки бесплатно. Это удобно, так как в жарких странах постоянно хочется пить. Но вид подходит тем, кто предпочитает отдыхать в отеле.
Расшифровка – Continental Breakfast. Это тоже вариант, предполагающий лишь завтраки, как и ВВ. Но завтрак будет очень легким и простым. Нередко на выбор предлагаются булочки и джемы, масло, чай и кофе. Иногда подаются колбаса и сыр.
Этот вид предполагает отсутствие питания в принципе. Расшифровывается как «room only». Так что если путевка имеет именно такое обозначение в графе «питание», то рассчитывать в отеле даже на завтраки не стоит. Кушать придется за свой счет. Кстати, подобными вариантами являются обозначения RP, OB, EP, BO, AO, NO. Включенных приемов пищи тут тоже нет, но в некоторых случаях отель предлагает оплатить его отдельно.
Это слегка расширенный НВ. При таком варианте и завтрак, и вечерний прием пищи сопровождаются напитками, входящими в стоимость приема пищи.
При наличии такого варианта человек питается три раза в день полноценно, да еще и имеет право бесплатно пить алкогольные напитки – обычно они представлены местными вариациями.

Виды завтраков

Чаще всего с целью экономии, да и для удобства тоже, туристы останавливаются лишь на вариантах с завтраком при выборе отеля для проживания. Именно поэтому стоит рассмотреть существующие вариации утреннего приема пищи в отелях.

Одна из разновидностей завтрака – это как раз континентальный завтрак
, который уже упоминался выше в таблице. Это выпечка, масло, джемы и напитки. Обычно такой вариант завтрака можно встретить в европейских отелях.

Также существует английский завтрак
, когда постояльцу предлагаются яичница различных видов, сосиски или поджаренный бекон, томаты или грибы. Также в дополнение ко всему перечисленному могут быть предложены тосты с маслом, фасоль, джем или мед, масло, такие напитки как кофе или сок.

Завтрак американского типа
может быть различным и часто зависит от сезона года. Обычно это – фруктовые салаты, сыр и колбаса, хлопья, йогурты.

В праздничные дни от некоторых отелей можно ожидать изысканный завтрак с шампанским
. Обычно он подается чуть позже, чем обычный вариант, и наряду со стандартными напитками гости могут получить вкусные десерты с игристым вином.

Также в ряде отелей есть такой вариант как поздний завтрак
, когда первый прием пищи близок к обеду. Отличный вариант для тех, кто любит поспать подольше. Подача блюд происходит в промежуток с 10:00 до 14:00.

Еще варианты обозначений завтраков

Также, раз уж речь идет обо всех возможных обозначениях вариантов питания в гостиницах, стоит рассмотреть подробнее еще одни варианты обозначений завтраков. Например, шведский стол или Buffet
характеризуется возможностью выбора блюд по своему вкусу и составления меню самостоятельно из предложенных вариантов. Конечно, вариации достаточно ограничены, но при этом на отсутствие разнообразия тоже пожаловаться нельзя. Это могут быть и мясо, и рыба, и всевозможные гарниры, а также десерты и фрукты в зависимости от того, что утвердило руководство отеля. Блюда находятся в специальных лотках или же на блюдах, нужно подходить и самостоятельно накладывать их себе в тарелку. Это самый распространенный вариант и наиболее удобный для большинства постояльцев. Можно сразу оценить вид и аппетитность блюда.

На заметку!
Шведский стол предполагает неограниченное количество употребленной пищи – к столам можно подходить несколько раз и брать сколько угодно еды. Но выносить еду за пределы ресторана запрещено.

А-ля карт или A-la carte
– вариант, предполагающий приобретение определенных вариантов блюд из меню. Здесь обязательно наличие официанта, который и будет обслуживать столик, поднося выбранные блюда. В зависимости от отеля пища может быть как платной, так и бесплатной, то есть входящей в стоимость путевки. A-la carte переводится как «по меню». Преимущество данного варианта – отсутствие толкотни возле лотков с едой как при шведском столе. Обычно для посещения ресторана нужно записываться у администраторов заранее.

Picnic или Poket Lunch
– вариант, который удобно брать с собой на экскурсии. Обычно можно попросить в отеле заранее собрать этот завтрак.

Питание детей

Многие путешественники предпочитают отдыхать всей семьей и, конечно, берут с собой в отпуск детей. Но детский организм достаточно своеобразен, и то, что можно есть взрослым, зачастую запрещено употреблять в пищу детям маленького возраста. И чем накормить малыша – часто довольно большой вопрос для отдыхающих на курорте родителей.

Некоторые отели предлагают специальное детское меню
. Оно может включать каши, диетические блюда, фрукты и овощи. Если же отель не предлагает детского меню, то лучше всего доплатить за него отдельно и кормить ребенка подходящей для растущего организма пищей. Особенно важно это в отношении поездок в экзотические азиатские страны или государства, расположенные на территории Африки. Непривычная еда может спровоцировать расстройство пищеварения, и тогда отдых будет и для родителей, и для детей настоящим испытанием.

На заметку!
Уточнить наличие детского меню в выбранной гостинице или отеле можно через туроператора или турагентство.

Выбор варианта питания целиком и полностью зависит от самого путешественника. Тут придется оценивать свои предпочтения, бюджет, а также возраст и ряд других особенностей. Лучше всего хорошо подумать, прежде чем хватать первую попавшуюся путевку. Вопрос питания для многих людей – один из важных при планировании отдыха.

Если человек предпочитает проводить время в отеле или на пляже возле него, то смысла отказываться от обедов и ужинов нет. Лучше всего взять тип питания «все включено». Тогда переживать за то, где и как поесть, а также что попить, вовсе не придется. Особенно, если вариант питания предполагает возможность пить напитки в любое время на территории отеля совершенно бесплатно. Да и для родителей с детьми это – далеко не самый плохой вариант. Ломать голову, чем накормить ребенка, не придется, так как пищу можно будет получить прямо в отеле и, скорее всего, качественную.

А вот если человек планирует активно передвигаться по стране, постоянно ездить на экскурсии и в отель приходить только для ночевки, то лучшим вариантом для него станет вариант питания, предполагающий только завтраки, либо полное отсутствие питания при заселении.

Видео – Виды питания: расшифровка

Выбирая варианты питания, следует учитывать собственные пожелания и нужды. Также важно обязательно уточнить малейшие аспекты по питанию у туроператора, если есть какие-то сомнения. Порой недочеты при планировании отпуска могут негативно отразиться на всем качестве отдыха. Даже если это – всего лишь ошибка при выборе типа питания.

Часто, бронируя отель, туристы сталкиваются с непонятными аббревиатурами и задаются вопросом, что такое RO, BB, HB, BF, AI, UAI? Все просто — это типы питания в отелях, их расшифровку и подробное описание от www.сайт смотрите ниже:

Питание RO (room only), RR (room rate), OB (Only Bed), AO (Accommodation Only)
такие аббревиатуры в отеле означают проживание в номере без питания.
Чаще всего встречается именно RO.
Питание BB (bed breakfast)
, означает «кровать и завтрак», т.е. при проживании в отеле по системе ВВ предоставляется кровать в номере и завтрак. Завтрак, как правило, предполагается в виде «шведского стола» и по обилию блюд зависит от уровня отеля и страны проживания. К примеру, завтрак по системе BB в центральной Европе значительно уступает варианту проживания BB в Греции или ОАЭ.
Питание HB (half board)
, что означает «полупансион» — завтрак и ужин. В некоторых дорогих отеля на завтрак может быть предложено бесплатное шампанское. Как правило, питание организовано по системе «шведский стол». Безалкогольные напитки по системе HB бесплатны, предусмотрен заказ платных алкогольных напитков с оплатой на месте или на номер.
Питание HB+ (half board plus)
такой же полупансион, но в варианте HB+ предусмотрены некоторые бесплатные алкогольные напитки, как правило, местного производства.
Питание FB (full board)
, или «полный пансион». Питание завтрак, обед и ужин, как правило, по системе шведского стола. По системе FB не предусмотрены бесплатные спиртные напитки, за исключением шампанского на завтрак в некоторых дорогих отелях. Алкогольные напитки по системе питания FB можно заказать на ужин за дополнительную плату.
Питание FB+ (full board plus)
— аналогично FB, но FB+ подразумевает некоторые бесплатные алкогольные напитки, как правило, местного производства.
Питание AI (all inclusive)
» «, многоразовое питание без ограничений. В зависимости от уровня отеля AI может быть от варианта трехразового питания, до многократного в течении всего дня — рестораны, барбекю, гриль, ночные бары и т.п. Бесплатные алкогольные напитки местного и реже импортного производства. Импортные спиртные напитки и коктейли по системе AI бесплатно только в дорогих отелях, в более простых отелях импортные алкогольные напитки за дополнительную плату и при их наличии.
Питание AIP (all inclusive premium)
«все включено премиум» — встречается редко. AIP аналогично AI, но с большим выбором спиртных напитков.
Питание UAI (ultra all inclusive, UALL)
тип питания по системе «ультра все включено» — многоразовое питание в течении всего дня по желанию в ресторанах разных кухонь мира, гриль-барах, в ночных барах и пр., в течении всего дня мороженое и сладости. UAI подразумевает бесплатные безалкогольные и алкогольные напитки местного и зарубежного производства.
Что такое шведский стол? Сайт www.сайт подскажет — шведский стол
это вид самообслуживания, при котором в зале находятся несколько больших столов и/или закрытых лотков на которых выставлены по типам блюда — салаты, гарниры, рыба, мясо, десерты и фрукты. Проходя мимо столов нужно выбирать блюда, которые нравятся и класть себе в тарелку.
В дорогих отелях бывают рестораны А ля Карт (A-lacarte)
, часто тематические и различающиеся по кухням мира. Здесь все как в обычном ресторане — выбираете блюда по меню и официант вам приносит заказы.
В зависимости от типа питания в отеле, рестораны «А ля Карт» могут быть как платные так и бесплатные. Бывает так, что если ресторан «А ля Карт» платный (что бывает редко при оплаченном питании AI или UAI), а у вас оплачено питание HB или FB, можно поужинать в таком ресторане со скидкой в счет ужина по системе «шведского стола». Важно помнить, что поужинать в таких ресторанах можно только по предварительной записи, причем, если ресторан хороший, то лучше это делать за несколько дней до его посещения.
А

Бронируя проживания в отеле, мы нередко сталкиваемся с различными типами питания. К сожалению, их расшифровка не всегда дается, поэтому сегодня мы решили восполнить этот пробел и подробно рассмотреть каждый из них.

Чаще всего встречается 3 типа питания: BB, НВ и FB

  • ВВ – Bed & Breakfast
    – тип питания, когда в стоимость проживания включен только завтрак. Обед и ужин в данном случае предоставляется только за дополнительную плату или отель вообще обслуживает только завтраки, в другое время придется кушать вне отеля.

Завтрак завтраку рознь, в каждой стране свои особенности, которые также стоит иметь в виду.

Континентальный завтрак
– самый распространенный в Европе, точнее на ее континентальной части. Иногда встречается и специальное сокращение – CB (Continental breakfast). Это очень легкий завтрак.
Вам подадут кофе/чай, выпечку, джем, масло. Иногда встречается расширенный континентальный завтрак, но не обольщайтесь раньше времени. К стандартному набору добавят йогурт, мюсли или хлопья и если повезет ветчину и сыр.

Другое дело или его еще иногда называют Американским завтраком (AB -American breakfast) , он очень сытный и калорийный. В классическом английском завтраке присутствуют сосиски, жаренный бекон, шампиньоны, помидоры, фасоль, яичница или омлет, тосты. Все это подают со стаканом сока или кофе/чаем. В США, к стандартному набору часто добавляют и небольшие блинчики – панкейки.

В Турции, Египте, Азии и в курортных городах Европы завтрак устроен по типу шведского стола. Разнообразие зависит от отеля, но в принципе из предложенных продуктов вы можете собрать оба варианта завтрака, иногда даже одновременно:)

HB – Half Board
– еще один популярный тип питания, полупансион. В Стоимость проживания включен завтрак и ужин.

FB – Full Board
– полный пансион или трехразовое питание. В стоимость включены завтрак, обед и ужин в установленное отелем время.

Минус данного типа питания в том, что он привязывает вас к отелю. Если вы захотите весь день провезти в городе, на пляже или экскурсии, то обед придется пропустить, т.к. возвращаться в отель – это потеря времени.

Если же вы наоборот любите проводить отпуск в отеле у бассейна, а по системе “Все Включено” отель не работает, то Full Board идеальный вариант для вас.

Обратите внимание, что во время обеда и ужина напитки не включены в стоимость.

Очень редко, но все же встречаются такие варианты как HB+ и FB+, как правило на курортах. Плюс в данном случае указывает на бесплатные напитки. По стандарту – это бесплатные напитки в течение дня.

Обратите внимание, что день – это не круглосуточно, в отеле установлены определенные рамки с _ и до _часов.

Кроме этого, есть отели, которые расшифровывают “плюс” по-своему. Нередко это означает, что напитки бесплатны только во время завтрака, обеда и ужина, в другое время за них надо платить.

AL -All inclusive
или “все включено”. Самый любимый тип питания у россиян. Повсеместно встречается в Турции и Египте. В последнее время эта тенденция дошла и до Болгарии и Греции, а также других популярных курортных направлений.

Питание All inclusive означает, что в стоимость проживания включены завтрак, обед, ужин, а также напитки в течение дня. Кроме этого есть дополнительные приемы пищи – поздний завтрак/бранч или полдник или то и другое.

Еще одна разновидность “Все включено” – это ультра все включено Ultra All Inclusive
. Скажем честно, эту формулировку иногда используют только для привлечения клиентов, нередко AL и UAL ничем не отличаются. По идее, “ультра все включено” включает помимо местных, напитки иностранного производства, более широкий выбор блюд и десертов. В некоторых отелях питание и напитки подаются практически круглосуточно, а также есть возможность ужинать в ресторанах A-la carte, где обслуживание осуществляется по меню.

Если питание не включено в стоимость, то это обозначается как RO (Room only), EP, BO, AO или NO.

Формы обслуживания в ресторанах отелей

Рестораны в отелях придерживаются одной из двух форм обслуживания – Шведский стол (Buffet) и обслуживание по меню (A-la carte).

– вы сами берете тарелку и накладываете те блюда, которые вам нравятся, в том количестве, котором хотите, если оно не ограничено отелем.

A-la carte
– это обслуживание по меню, как в обычном ресторане. Вы выбираете блюда из меню, обслуживает вас официант. В отличие от обычных ресторанов, во многих отелях выбор блюд в меню ограничен, например 2 варианта салатов, 2-3 варианта горячих блюд и т.д.

Во многих отелях встречается смешанная форма питания, завтрак в виде шведского стола, а обед и ужин по меню.

16 Дек 2013
Анна Комок
Метки:

При выборе тура, немаловажным моментом является и выбор питания по нему. От этого будет многое зависеть, в том числе, это будет влиять на ваше общее впечатление об отдыхе. У многих, особенно начинающих путешественников часто вызывают недоумение условные сокращения, которыми отель указывает на предлагаемые виды питания. Для того, чтобы вы смогли легко разобраться с этими «подводными камнями» отдыха, просим вас внимательно изучить эту статью.

Итак, практически все отели стараются следовать основным условным обозначениям, но бывают и некие расхождения. Кроме того, не стоит заблуждаться, что богатство выбора и качество предлагаемых блюд в отелях разной категории звездности будет одинаковым, например, если вы решили выбрать питание по системе «все включено» в отеле «три звезды» или отеле «пять звезд». Очевидно, что в последнем будет более широкий выбор продуктов и кушаний, а также более эксклюзивное качество конечного продукта.

Вообще, выбор типа своего питания в отеле, необходимо делать, исходя из целей своей поездки. Если вы собрались посетить страну, чтобы проехать по интересным историческим местам, значит, вы не будете безвылазно сидеть в отеле, а, значит, и выбирать питание из серии: все включено или завтрак, обед, ужин – вам не стоит, зачем попусту тратить деньги? Лучше вам взять питание: завтрак или завтрак, ужин. А когда приезжаете только на пляжный отдых, как у нас любят говорить «овощной», тогда, конечно, вам лучше брать питание по системе «все включено» или «ультра все включено», чтобы и питание и напитки, десерты в любое время были в шаговой доступности, и все уже было оплачено. А вообще, впервые приезжая в страну, многие стараются познакомиться с ее кухней, в местных кафе, барах и ресторанах, ведь только питаясь в уличных заведениях можно проникнуться духом города и местности, так как меню отелей более обобщенное и подогнанное к общеевропейскому вкусу. Хотя многие, уважающие себя гостиницы, устраивают дни культур различных народов: и тогда работники и официанты ресторана одевают соответствующие костюмы той страны, кухню которой они сегодня представляют своим гостям, предлагают угоститься национальными напитками, играет народная музыка и т.д.

Шведский стол
. Вообще, самой любимой системой питания наших соотечественников и очень распространенной вещью является «шведский стол», когда любой отдыхающий самостоятельно ходит по ресторану с тарелкой и набирает с общих столов все, что ему приглянулось: любые закуски, нарезки, салаты, горячее, десерты: фрукты, сладости, напитки, спиртное – в любом количестве любое число раз, при условии, что выносить еду из зала нельзя. За этим вопросом в одних отелях строго следят, в других закрывают глаза, все зависит от коллектива сотрудников отеля.

ВВ — завтрак
. Питание системы «шведский стол» имеет обозначение «BB или BBF», расшифровываясь «Buffet Breakfast». Это самый обильный вид завтрака, распространенный во многих отелях мира, включающий в свой ассортимент мясную, сырную нарезки, молочные продукты, колбасы и мясо, фрукты с овощами, мучные изделия: хлеб, выпечку разновидности булок, плюшек, ватрушек, кондитерские изделия – торты, пирожные, эклеры и т.п., напитки – различные соки, чай пакетированный, кофе, горячий шоколад, иногда алкоголь местного производства. Понятно, что ассортимент может меняться в зависимости от выбранной категории отеля. Но, в любом случае вы сможете взять нужное вам количество в любое число подходов.

Континентальный завтрак
. Этот вид питания более скромен в отличие от «шведского стола», выбор продуктов тут ограничен соком, чаем, кофе, булочкой с маслом, джемом или медом. Изредка вам могут предложить сырную нарезку. Обозначается континентальный завтрак – «CB или CBF», расшифровываясь «Continental Breakfast». Как вы поняли это облегченный вид завтрака. У континентального завтрака могут быть разновидности: американский завтрак — «AB или ABF» — «american breakfast / buffet». И это более сытный завтрак, так как в этом случае он дополнен колбасной и сырной нарезками, а также горячими блюдами, такими как яичница, омлет, сосиски.

«English Breakfast»
— английский завтрак – чуть поскромнее американского варианта, но тоже довольно сытный, в отличие от континентального: чай, кофе, сок, яичница с ветчиной, тосты, сливочное масло, мед, джем.

Полупансион
– HB. Вариант питания «НВ» – «half board» – это когда цену за проживание в отеле уже включено неполное питание: завтрак и ужин или завтрак и обед, на выбор, по системе «шведский стол» с бесплатным чаем, горячим шоколадом, соком, кофе или водой на завтрак.

У полупансиона имеются несколько разновидностей. «HB+» это более расширенное питание полупансион- завтрак и ужин или завтрак и обед по системе «шведский стол», когда вы можете еще дополнительно пить бесплатные алкогольные, а также любые безалкогольные напитки, правда, строго местного производства в течение всего дня, за импортный алкоголь придется доплачивать.

Полный пансион
– FB. «FB» — означает «full board» и переводится «полный пансион», подразумевающий завтрак, обед с ужином, все по той же системе «шведский стол». Этот вариант может быть расширенным и обозначаться «FB+» или «EXTFB» — это когда, к питанию завтрак, обед, ужин по системе «шведский стол», дополнительно бесплатное предоставление вам напитков безалкогольных и алкогольных: пиво, вино.

Питание по «DNR»
. «Dinner» — значит «ужин». Питание по этой системе бывает двух основных видов: «шведский стол» и выбор блюд, прописанных в меню, но ограниченного парой-тройкой вторых блюд, плюс разнообразные холодные закуски и салаты. В последнем случае на ужи предлагают то же, что и на завтрак.

Питание «Mini all inclusive»
. Этот вид питания предлагает своим гостям полный пансион: завтрак, обед, ужин и дополнительно напитки местного производства. Отличие этого вида питания от «FB+» — это то, что напитки вы можете пить не только во время еды, а в любое время суток, в ограниченном количестве.

Питание «AL»
. Питание по системе «все включено» — это когда в сумму проживания включен завтрак, второй завтрак, обед, ужин, полдник, поздний ужин, питание в барах легкими закусками, барбекю, бесплатные безалкогольные и алкогольные напитки местного производства в течении всего дня.

У AL есть много подвидов, например, «HсAL» — «hign class all inclusive» — все включено по высшему классу. То есть, все, что отель предлагает своим гостям включено в оплаченную вами стоимость проживания. Это означает, что за исключением товаров в магазинах отеля, использования телефона, посещения врача, пользования услугами парикмахерской отеля, а также занятия некоторыми водными видами спорта, в том числе и дайвинга, все остальное вам предоставляется бесплатно.

Система «ultra all inc»
— «ультра ол инклюзив» — это когда питание весь день и все напитки, в том числе и импортные спиртные, предоставляются вам бесплатно. При этой системе питания вам предложат широкий выбор сладостей, различных десертов, всевозможные закуски, огромный выбор напитков местного и импортного производства, в том числе очень дорогое импортное спиртное.

Питание по системе «ultra all inclusive I Wish»
— когда включен завтрак, обед, ужин по системе «шведский стол», дополнительно включены ночные закуски, приветственная бутылочка вина по приезду – одна штука, алкогольные и безалкогольные напитки местного производства, использование сауны и джакузи в течение двух часов, бесплатный виски и ром, импортного производства, а также кампари и мартини.

В зависимости от вида отеля, работающего по системе «Ultra All Inclusive», гостям предлагается питание в ресторанах, ориентированных на национальную кухню разных стран, а также питание в ресторанах по «а-La carte», а также прочие бонусы на усмотрение администрации. А разновидностей питания по системе «ultra aIl inclusive» так много, что в них недолго запутаться: «Elegance all inc», «VIP all inc», «Super all inc», «De luxe all inc», «VC all inc», «Superior all inc», «MEGA all inc», «Superior all inc VIP Service», «Royal Class all inc», «Ultra de luxe all inc», «Extended all inc», «Exellent all inc», «Max all inc», «Imperial all inc».

Есть еще один интересный подвид питания «Club pharaon», когда в цену проживания включен завтрак, обед, ужин по системе «шведский стол», напитки алкогольные и безалкогольные местного производства, а по приезду вам преподнесут фрукты, бутылку вина, кондитерские изделия и приветственный коктейль. В номере вас будут ждать тапочки с халатом. Кроме того, вам положены полчаса бесплатного массажа и интернета, а также пользование теннисными кортами также бесплатное.

На сайтах отелей могут встречаться такие символы:

— «ОВ» — «only bad», что значит, что вы заплатили только за кровать, то есть только за ночевку в отеле;
— «RO» — «room only», значит, вы оплатили только комнату;
— «NA» — «not available» — проживание без питания или «EР» — «Except Pation», также означает, что проживание без питания, кроме того может быть идентичное обозначение «AO» — «Accomodation only», «ВО», все это означает, что вы оплатили только размещение в отеле;
— понятие «a-la carte» — это меню, где указана цена каждого блюда.

Существует еще и альтернативной классификация, которой отели также пользуются, но редко:

— AP — «american plan» — полный пансион: завтрак, обед и ужин, идентичен «FB»;
— BP –«bermuda plan» — плотный американский завтрак;
— CP – «continental plan»- континентальный завтрак, о нем мы уже рассказывали;
— «EP» — «european plan» — вообще, проживание без питания;
— «MAP» — «modified american plan» — разновидность полупансиона «FB», при этом, иногда в стоимость проживания и питания включен «British-style afternoon tea» — традиционный британский чай после полудня.

Ну, вот, наверное, и вся расшифровка, возможных вариантов питания, предлагаемых отелями своим гостям. Очень хочется надеяться, что теперь вы станете более грамотными и опытными путешественниками.

Собираясь на отдых за границу, путешественникам предстоит решить нелегкую задачу по подбору отеля размещения. От правильности выбора будет зависеть качество отдыха. Многие не полагаются на советы туроператоров, а принимают решения самостоятельно на основе отзывов и описаний гостиниц.

Одна из сложностей, с которыми придется столкнуться при поиске отеля, — буквенные обозначения системы питания. Что же означает эта загадочная аббревиатура UAI и чем она отличается от многих других?

Что значит питание UAI?

Изучая условия размещения в крупных дорогих отелях, довольно часто можно увидеть именно это буквенное обозначение. Такое обслуживание принято рассматривать, как высшую степень комфортабельности и качества сервиса.

Питание UAI при расшифровке дает определение Ultra В переводе на русский это звучит как система «Все включено. Ультра». Согласно правилам, в стоимость проживания уже включено многоразовое питание постояльцев, а именно:

  • завтрак;
  • второй легкий завтрак;
  • обед;
  • легкий ланч;
  • ужин;
  • мороженое и выпечка в течение дня;
  • барбекю;
  • прохладительные напитки и алкоголь местного и зарубежного производства.

Основные рестораны отелей обслуживают постояльцев по системе “шведский стол”, при котором каждый посетитель может выбрать из предложенных на столе блюд, именно то, что ему хочется.

Еще одна особенность питания UAI, что распространяется на бары и снек-бары отеля. Иными словами, постояльцы могут свободно посещать все заведения общественного питания на территории гостиницы бесплатно — все уже включено в стоимость проживания.

Различие между AI и UAI

В целом, эти две системы питания очень похожи между собой. Однако различия все же существуют.

All Inclusive (или сокращенно AI) означает включение в стоимость проживания многоразового питания в главном ресторане отеля и барах. Однако некоторые услуги доступны только при дополнительной оплате. В основном, это касается алкоголя после 23:00, заказов импортных напитков, алкоголя и барбекю.

В чем отличие питания UAI? Что эта система предлагает круглосуточное питание в любое время с возможностью заказа всех видов блюд. Это касается и напитков.

Еще одной немаловажной деталью можно назвать бесплатное питание в ресторанах Это те заведения отеля, которые обслуживают посетителей по меню и предлагают кухню разных стран. При системе «Все включено» посещение таких мест платное или ограниченное (1-2 раза за 7-10 дней).

Стоит ли выбирать размещение по системе Ultra All Inclusive?

Такую систему размещения предлагают далеко не все отели. Обычно эти условия встречаются только в очень крупных фешенебельных гостиницах. Много предложений поступает от отелей Турции и Египта.

Стоит ли выбирать такую путевку, каждому туристу придется решать самостоятельно, исходя из собственных потребностей в рационе. При этом стоит помнить, что — UAI, значительно повышает стоимость тура.

Чтобы принять правильное решение, учитывают следующие моменты. Цель путешествия — если туристы планируют посетить много экскурсий и путешествий по окрестностям, им придется часто питаться вне отеля (это дополнительные траты).

Это говорит о том, что это питание —
UAI,
может стать просто ненужной услугой.

Предпочтения в алкоголе — если планируется тихий семейный отдых без обильных возлияний, то можно обойтись системой «Все включено».

Разобравшись в Ultra All Inclusive, отдыхающим будет гораздо легче выбрать отель по типу питания. Это гарантирует качественный отдых и рациональные финансовые траты.

Типы питания в отелях. Расшифровка видов питания RO, BB, HB, BF, AI, UAI

Бронирование тура в Египет или Турцию почти никогда не вызывает вопросов у туристов: all inclusive — фраза, знакомая каждому. Но можно растеряться, если рядом с названием гостиницы вы увидите незнакомые аббревиатуры.

Чтобы отдых не был омрачен неприятными сюрпризами, советуем при выборе тура всегда смотреть на расшифровку типа питания в отелях.

Во всем мире принята стандартная система обозначения. Вы можете встретить следующие варианты:

  • без питания;
  • только завтраки;
  • завтрак+ужин;
  • трехразовое питание;
  • все включено.

А также множество различных вариаций всех этих видов питания в отелях. Мы собрали аббревиатуры в небольшую шпаргалку, чтобы вам было легко ориентироваться.

Только проживание в отеле: какие бывают обозначения?

Планируете ранние выходы или поздние возвращения в отель или хотите отведать местную кухню? Тогда ваш выбор — номер без еды — это самый дешевый вариант в гостинице.

Если увидели такие буквенные сокращения в описании отеля — питание в цену проживания не включено:

С английского все эти обозначения можно перевести как: «только номер» или «цена за номер».

Можете заказать еду отдельно или приготовить самостоятельно на общей кухне или в номере. Если у отеля есть такая возможность, это указывается в описании дополнительно и обозначается аббревиатурой SС (self catering).

Расшифровка обозначений питания в отелях с завтраком

Под загадочными буквами ВВ подразумеваются кровать (англ. bed) и завтрак (англ. breakfast).

Если вы не собираетесь быть в гостинице целый день или останавливаетесь на одну ночь, ВВ — идеальный выбор. Это одна из самых распространенных категорий в европейских городах, куда туристы приезжают ради экскурсий или прогулок. Стоимость завтрака включена в цену номера.

Завтраки могут быть разные:

Название завтраковБуквенное обозначениеЧто включает в себя завтрак
Английский (он же американский) завтракEB /АВ = english (american) breakfastПоджаренный бекон или колбаса, блюдо из яиц (чаще всего это яичница, но иногда и омлет), горячие напитки (чай, кофе). Дополнительные ингредиенты отличаются в зависимости от региона (например, тосты), но яйца с беконом присутствуют в английском завтраке всегда.
Континентальный завтракCB = continental breakfastКруассаны или мини-булочки, масло, джемы и всякие дополнения к ним, йогурт, несколько кусочков сыра и колбасы,горячие напитки. Наиболее распространенный вариант в бюджетных европейских отелях.
Шведский столBBF = buffet breakfastМного разных блюд выставлены рядом, вы подходите к столу и кладете себе на тарелку понравившуюся еду. Обычно выбор пищи достаточно большой: фрукты, мюсли, булочки, сыр, колбаса, вареные яйца, разнообразные напитки и т.д.

Что такое питание по типу «пансион»?

Немного старомодное слово пансион (англ. board) в отельном бизнесе означает питание два или три раза в день. Легко догадаться, что первый, урезанный, вариант — это полупансион, второй — полный.

Такой тип питания имеет свои обозначения и классификации:

НазваниеБуквенное обозначениеЧто включает
ПолупансионHBПитание утром и вечером без напитков.
Полупансион +HB +То же самое +дополнительные напитки, включая спиртные.
Полный пансионFBПитание три раза в день.
Полный пансион +FB +То же самое +алкоголь и напитки.

Питание в отелях категории «все включено»

Любимый тип питания в отелях для многих туристов — ведь о поиске еды и напитков можно не беспокоиться весь отпуск. В стоимость проживания входят три стандартных приема пищи, разнообразные перекусы, барбекю, спиртные и безалкогольные напитки.

Расшифровка обозначения питания в системе «все включено» очень простая:

  • ALL, Al, AL — all inclusive. Это все, что перечислено выше: трехразовое питание, закуски, алкоголь, напитки и т.д.
  • UAI, UAL — ultra all inclusive — расширенный выбор алкогольных напитков и блюд.
  • ALL De Luxe/ High Class/Royal Class/Superior — VIP сервис: кроме полного all inclusive питания, в эти пакеты входят различные услуги, которые предоставляют только отели высочайшего класса. Это могут быть шоколад, мороженое, фрукты и напитки в номер, бесплатный алкоголь в мини-баре и т.д.
  • Mini all inclusive — а это, наоборот — урезанный вариант. Что-то среднее между полным пансионом и all inclusive, при этом количество напитков ограничено.

Другие категории питания в гостиницах

Некоторые виды подачи еды встречаются не так часто, но о них тоже стоит знать:

  • Brunch dinner + (завтрак, переходящий в обед) — часто практикуется в отелях на горнолыжных курортах. В поздний завтрак помимо еды, входят напитки. А в отдельных регионах также предлагают местные слабоалкогольные напитки (вино или пиво).
  • А-la-carte — обслуживание по меню в ресторане отеля. Иногда в цену номера может входить несколько бесплатных посещений ресторана, иногда все блюда платные.

Как выбрать правильный тип питания в отеле?

Итак, вы определились с планами на отдых. Как выбрать подходящий сервис, чтобы не переплатить, но и не тратить много времени на поиск еды?

Мы разработали для вас небольшую таблицу с параметрами отдыха и подходящими вариантами питания. Сверьтесь с ней, чтобы отпуск прошел максимально комфортно:

Планы на отпускБез питанияЗавтракиПолупансион или полный пансионВсе включено
Следите за фигурой или придерживаетесь диеты++
Хотите посещать много экскурсий или гулять по городу+++
Хотите познакомиться с местной кухней++
У вас нет ограничений по питанию и бюджету++
Вам не нравится местная кухня++
Вы не хотите беспокоиться о поиске еды и тратить деньги в ресторане++

Помните также о некоторых важных моментах:

  • ⭐ Если комфорт для вас превыше всего, а бюджет поездки неограничен, выбирайте программы «все включено» высокого класса — у вас всегда будут свежие фрукты и напитки на любой вкус. Особенно это важно в экзотических странах — ведь всегда есть риск, что местная кухня не придется вам по вкусу, а в люксовых отелях подадут еду по вашим пожеланиям.
  • ⭐ Если вы не употребляете спиртное или имеете ограничения в еде, не переплачивайте за all inclusive — выберите завтраки или полупансион, а в остальное время готовьте сами или тестируйте местную кухню.
  • ⭐ Не переоценивайте свои силы — если отпуск состоит из активных прогулок, а в отель вы приходите только поздно вечером, не переплачивайте за ужин. Лучше выбирайте гостиницы, в которых есть свой ресторанчик или возможность заказать еду за отдельную плату.
  • ⭐ Любите поспать подольше? Поинтересуйтесь, до которого часа подают завтраки.Обычно они длятся с 7 до 10 утра (иногда до 11). Если вы не готовы пожертвовать сном ради завтрака, выбирайте другие типы питания или завтракайте за пределами отеля.
  • ⭐ Выбирая all inclusive, помните не только о преимуществах этой системы в виде комфорта, но и о минусах: дороговизне и риске набрать лишние килограммы.
  • ⭐ Полупансион или полный пансион — отличный выбор для тех, кто не готов переплачивать за «все включено»: вы точно не останетесь голодным и сэкономите денег.
  • ⭐ В некоторых странах, например, в ОАЭ, посещение ресторанов обойдется намного дороже, чем питание в отеле. Поэтому выбирайте HB, FB или all inclusive.

Чтобы не ошибиться в выборе, заглядывайте в нашу инструкцию при выборе тура. Мы желаем вам только комфортных и приятных поездок!

Типы питания в отелях: RO, BB, HB, FB, AI, UAI, что означают и что лучше выбрать?

Если вы не хотите с сожалением обнаружить, что приглянувшийся вам дешевый отель не предоставляет питания и теперь это для вас внезапная головная и финансовая боль, то собираясь в отпуск или деловую поездку, вам стоит обратить внимание на такой критерий, как тип питания в отеле.

В описании отелей тип питания обозначается буквенным сокращением — например, HB, FB или AI. Какие же бывают сокращения и что они под собой подразумевают? Чем отличается отель all inclusive от отеля BB?

Мы собрали для вас всю необходимую информацию для ответа на эти вопросы.

NA, OB, BO, RO, AO, SF, BB, BBL, CB, CBF, EB, AB, ABF, CA, BBF, HB, HB+, FB, FB+, Brunch dinner +, Mini All Inclusive, ALL, All, AI, FSAI, AI De Luxe, AI Fine Service, AI High Class, AI Plus, AI Royal Class, AI Superior, UAL, UAI, A-la-carte

Размещение без питания

NA (Not Available)

Не доступно

OB (Only Bed) или BO (Bed Only)

Только кровать,  т.е. только проживание

RO (Room Only)

только комната.

AO (accommodation only)

только размещение

SF (self catering)

Самообслуживание. Размещение без питания, но в вашем номере вам будут предоставлены основные кухонные принадлежности, такие как плита, чайник и микроволновая печь. Этот вариант подходит тем, у кого небольшой бюджет, так как вы можете купить еду в супермаркетах и готовить для себя самостоятельно.

Эти аббревиатуры в графе «Питание» означают, что в базовом варианте еду в отеле вам не предложат — только проживание. Иногда питание можно заказать дополнительно по приезду, однако оно может отсутствовать и вовсе.

Гостиницы, предлагающие только проживание, привлекают туристов своей ценой. Однако прежде чем выбрать такой вариант, просчитайте, во сколько вам обойдется питание в кафе и ресторанах на весь срок проживания. Зачастую оказывается, что выгоднее сразу выбрать отель с питанием. На известных курортах такой вариант питания встречается весьма редко. Он больше характерен для небольших городских гостиниц и апартаментов.

Размещение с питанием

BB (Bed and Breakfast)

Кровать и завтрак. Этот тип обозначает, что в стоимость проживания включены завтраки. Такой вариант питания чаще всего предлагают гостиницы в Европе, где очень развит экскурсионный туризм. Подобные туры подразумевают ранний выезд из отеля, многочисленные экскурсии на протяжении дня и позднее возвращение в гостиницу. В этом случае пообедать и поужинать удобнее на маршруте.  В таких странах как США, Мексика, Сингапур и Австралия завтрак, обычно, заказывают по желанию, и оплачивают на месте

BBL (BB+Lunch)

Завтрак, обед.

CB, CBF (Continental Breakfast) — континентальный завтрак

Это самый легкий вариант завтрака. Обычно подают чай или кофе, сок, булочки, джем, масло, сыр, творог, яйцо, вам также могут предложить фрукты или йогурт. Чаще всего такой вид завтрака предлагают во Франции, но сам тип питанию присущ многим Европейским отелям 2*-5*.

EB (English Breakfast) — английский завтрак.

Состоит из кофе или чая, сока, тостов, масла, джема и обязательно яичницы, каши.

AB, ABF, CA (American Breakfast) — американский завтрак.

Аналогичен континентальному завтраку, но помимо составляющих CB включает различные мясные и сырные нарезки и горячие блюда (омлет, яичница, сосиски). Питание по меню, на выбор предлагается ограниченное число блюд из меню. Этот тип питания часто встречается в Америке и странах Западной Европы.

BBF (Buffet Breakfast) — шведский стол.

При таком варианте вы можете брать себе сколько угодно еды, но выносить продукты из ресторана запрещено.  Конечно, этот вид завтрака самый сытный и любимый туристами.

HB (Half Board) — полупансион.

Как и вариант BBL, такая система предполагает двухразовое питание, однако обычно это завтрак и ужин (шведский стол). Крайне редко гостиницы предлагают заменить ужин на обед, без проблем эта услуга оказывается только в отелях ОАЭ. При таком типе питания чай, кофе и вода бесплатно предоставляются только на завтрак. Все напитки за ужином — за дополнительную плату, недопитые бутылки со спиртными напитками подаются на следующем ужине. Каждый раз рассчитываться за выпитые напитки не требуется, достаточно официанту назвать номер своей комнаты, и общий счет вам предоставят при выселении из отеля.

Этот вариант питания очень распространен в отелях уровня 3* и 4*. Такая система подходит и для туристов, которые планируют непродолжительные экскурсионные поездки, либо для тех, кому достаточно в качестве обеда перекусить в кафе на пляже.

HB+ (half board +, extended half board) — расширенный полупансион

Завтрак и ужин (шведский стол), а также алкогольные и безалкогольные напитки местного производства весь день.

FB (Full Board) — полный пансион.

Это трехразовое стандартное питание: завтрак, обед и ужин (шведский стол). Такой вариант незаменим для тех, кому важно кушать регулярно, при этом не увлекаясь спиртным: все алкогольные и безалкогольные (кроме кувшина с водой) напитки за обедом и ужином предлагаются за дополнительную плату.

FB+ (Full Board Plus), ExtFB (Extended Full Board) — расширенный полный пансион.

От обычного FB отличается тем, что во время приема пищи бесплатно предлагаются спиртные напитки (в ряде отелей пиво и вино).

Brunch dinner +

Тип питания, распространенный на горнолыжных курортах, завтрак перетекающий в ранний обед (без перерыва между ними) и ужин, а также алкогольные (вино и пиво) и безалкогольные напитки местного производства.


Лучшие цены на туры в Анталию


Mini All Inclusive

Полный пансион с напитками местного производства не только во время еды, но в ограниченном количестве;

ALL, All или Al (All Inclusive) — все включено.

Cистема обслуживания в отелях, в соответствии с которой трехразовое питание, напитки и отдельные виды услуг предоставляются бесплатно. Разновидностью системы является max inclusive, когда перечень дополнительных услуг может быть существенно расширен (бесплатное пользование парикмахерской, спортзалом и т.д.).

В испано-язычных странах может встречаться местное наименование All Inclusive — t.i. или Todo Incluido.

FSAI — Full Sale All Inclusive

Напитки до 23.00 по системе все включено, но импортные напитки платно.

All inclusive De Luxe

В каждом номере – банный халат и тапочки. В день приезда гостям подаются свежие фрукты. Обслуживание – полный пансион, включая алкогольные и безалкогольные напитки местного и импортного производства, мороженое, напитки в мини-баре, обслуживание в номерах (room service), посещение специализированных ресторанов а-ла карте.

All inclusive Fine Service

В каждом номере предоставляются банный халат и тапочки, ежедневно в номере – свежие фрукты, шоколад. Полный пансион, алкогольные и безалкогольные напитки местного и импортного производства, специализированные рестораны а-ла карте, мороженое, напитки в мини-баре, обслуживание в номерах, тур на яхте.

All inclusive High Class

Полный пансион, алкогольные и безалкогольные напитки местного и импортного производства, специализированные рестораны а-ла карте, мороженое, напитки в мини-баре, обслуживание в номерах, массаж, прачечная, боулинг, курсы обучения игры в теннис. Бесплатно все, кроме магазинов, телефона, врача, парикмахерской, некоторых видов спорта и подводного плавания.

All inclusive PLUS

Полный пансион, алкогольные и безалкогольные напитки местного производства, специализированные рестораны а-ла карте, мороженое, вода в мини-баре.

All inclusive Royal Class

Полный пансион, алкогольные и безалкогольные напитки местного и импортного производства, специализированные рестораны а-ла карте, мороженое, в мини-баре: вино, пиво, прохладительные напитки, обслуживание в номерах, интернет-кафе, боулинг, курсы обучения игры в теннис.

All inclusive Superior

В каждом номере – банный халат и тапочки, ежедневно в номер доставляются свежие фрукты, шоколад. Полный пансион, алкогольные и безалкогольные напитки местного и импортного производства, специализированные рестораны а-ла карте, мороженое, напитки в мини-баре, курсы обучения игры в теннис, мини-гольф.

UAL, UAI (Ultra All Inclusive или Ultra AI) — ультра все включено.

Завтрак, поздний завтрак, обед, полдник и ужин – шведский стол. Достойный выбор десертов, всевозможных закусок, напитков местного и импортного производства. Большинство отелей, работающих по системе Ultra All Inclusive, также предлагают гостям дополнительное бесплатное питание в ресторанах с кухней разных народов мира. В каждом номере – банный халат и тапочки, в день приезда гостяма подаются свежие фрукты. Специализированные рестораны а-ла карте, мороженое, напитки в мини-баре, массаж, интернет-кафе, курсы обучения игры в теннис.

Вариации Ultra All Inclusive

Elegance all inc, VIP all inc, Super all inc, De luxe all inc, VC all inc, Superior all inc, MEGA all inc, Superior all inc VIP Service, Royal Class all inc (RALL), Ultra de luxe all inc, UTA (Ultimate All Inclusive или Ultimate AI), Extended all inc, Exellent all inc, Max all inc, Imperial all inc

Формы подачи питания

A-la-carte

Обслуживание по меню официантам. Как правило, такие рестораны тематические: рыбный, барбекю, китайский, итальянский, мексиканский и др. Напитки предлагаются более высокого класса, чем в обычном ресторане и барах. Количество бесплатных посещений таких ресторанов нужно уточнять у администратора отеля.

Шведский стол

Питание по банкетной системе с неограниченным количеством подходов

Буфет

Более скудный вариант шведского стола


Хотим напомнить, что на нашем сайте вы всегда можете подобрать себе отель или готовый тур.

Мощность HB. Типы питания в отелях: стенограмма

Что такое FB-питание? Перед тем, как отправиться в отпуск, многие люди начинают заранее задумываться, как правильно и с максимальной отдачей его потратить. Кто-то хочет съездить в деревню и заняться ее благоустройством, кто-то мечтает о далеких краях и красивых пятизвездочных отелях. Планируя поездку, нужно заранее знать подробности об окрестностях, достопримечательностях и, конечно же, не забывать о еде.В этой статье мы поговорим о последнем моменте, , что означают отели FB? ?
Однако, прежде чем продолжить, рекомендую прочитать еще пару полезных новостей на случайные темы. Например, кого называют злым человеком; что означает Видение, что такое Клевета, как понимать выражение «Духовная жажда» и т. д.
Рекомендую добавить наш сайт в закладки, чтобы снова посетить этот образовательный ресурс.
Итак, продолжим FB питание что значит ? Эта аббревиатура расшифровывается как « полный пансион, », и переводится как «полный пансион».«

FB в отелях — Это полный пансион, который включает завтрак, обед и ужин

Что означает тип питания в отелях BB?

Как вы, наверное, сами понимаете, еда в отеле играет одну из самые важные роли.Этот пункт необходимо уточнять при выборе отеля и покупке билета.

С давних времен была разработана градация, обозначающая разные виды еды, состоящие из букв латинского алфавита. Сегодня почти каждый отель придерживается эти правила.Поэтому нужно учитывать, что основной набор блюд будет существенно различаться в зависимости от класса отеля.

Давайте посмотрим, насколько тип питания « полный пансион » удобен и кому он больше всего подходит. Как уже было сказано выше, это завтрак, обед и ужин. Как правило, в утренние блюда входят разнообразные соки и горячие напитки, а на ужин и обед их заказывают за дополнительную плату.

Совсем недавно был разработан новый стандарт — « Fb plus ».Это все тот же трехразовый пансионат, но с одной пристройкой. В него стали включать алкогольные и безалкогольные напитки, как хотите. К сожалению, алкоголь не очень качественный и, как правило, местного производства.

Каждый, кто выбрал систему Fb , не пожалеет, ведь она гарантирует полноценное и разнообразное питание. Вам не нужно думать о том, где перекусить и сэкономить немного денег.

Обычно FB — это пресловутый « буфет », о котором многие слышали, но не все пробовали.Это действительно отличное изобретение, и не только для гостей, но и для персонала. Подходы к еде и сами порции не ограничены. Главная особенность — самообслуживание, которое позволяет посетителям не зависеть от работников отеля. Официанты в этом случае следят за тем, чтобы стол всегда ломился от еды, и при необходимости моют грязную посуду.
В редких случаях в некоторых отелях обед подается по заранее составленному меню, включая горячее, салат и суп.

Где я могу найти отели FB?

Этот вид еды распространяется по всему «балу», но наибольшую популярность этот вид «обжорства» приобрел в курортных странах, таких как Тунис, Египет, Турция, то есть там, где часто бывают российские туристы.В Евросоюзе этот вид пансионатов не особо востребован из-за европейской жадности и бедности. Как я могу попросить вас отправиться в отпуск, если вы все в долгах и кредитах? Так что жители Евросоюза крутятся, как умеют, предпочитая более дешевый вид отдыха. Ведь в курортных городах неслучайно такое огромное количество кафе с недорогими едят блюд. Понятно, что в целях экономии туристы будут питаться вне отеля.

Стоит отметить, что FB-еда не нравится и большим любителям всевозможных экскурсий.Потому что им может быть очень сложно успеть поужинать. Обычно Fb food популярны в курортных городках, где никуда не хочется ехать. Все сидят на пляже и загорают, как послушные «детишки».

Да, чуть не забыл, отели FB тоже подходят для отдыха с детьми. Ведь имея в руках ношу в виде маленьких детей, никто в здравом уме не протоптал бы пару сотен километров, чтобы увидеть пирамиды Гизы. Как бы то ни было, дети хотят есть гораздо чаще, чем взрослые, потому что у них молодой и развивающийся организм.

Прочитав эту статью, вы узнали, что Fb Nutrition означает , и теперь вы будете в курсе, когда начнете планировать свой следующий отпуск.

Мы, как правило, заранее убеждаемся, что он соответствует нашим предпочтениям. Речь идет о комфорте, удобствах, развлечениях и, конечно же, питании (см. Наш раздел «»).

Эта статья создана для того, чтобы ваш отпуск прошел хорошо. В нем вы найдете всю необходимую информацию о питании в отелях за рубежом, разбивку сокращений, используемых в характеристиках отеля в отношении питания.

Согласно правилам, виды питания, указанные в данной информации об отеле, уже включены в стоимость. И это очень важная деталь при составлении бюджета будущего отпуска.

Типы питания в отелях

Тип (тип) питания в отеле указывается в описании (описании) гостиничного номера сразу после типа бронируемого вами жилья. Его аббревиатура состоит из двух или трех латинских букв. Полный список:

RO (без питания) — проживание без питания.

EP (европейский план), Bo (только кровать), Ao (только проживание), Rr (стоимость номера), OV (только кровать), NO — проживание без питания.

BB (Ночлег) — завтрак включен в стоимость (может быть организован по типу шведского стола). Меню такого обеда состоит из холодных и горячих блюд, напитков. Ассортимент блюд зависит от традиций страны и предпочтений владельцев отеля.

HB (полупансион) — полупансион, который включает в себя завтрак и ужин (может быть организован согласно шведскому столу), кроме того, вы можете бесплатно заказать чай, кофе, воду.

HB + (полупансион +, расширенный полупансион) — система питания отеля построена по принципу расширенного полупансиона, завтрак и ужин (шведский стол) включены в стоимость, дополнительно можно заказать местную алкогольную и безалкогольные напитки в течение дня, которые доступны в баре отеля.

Fb (Полный пансион) — полный пансион (завтрак, обед и ужин), питание — шведский стол.

Fb + (полный пансион +), EXTFB (расширенный полупансион) — аббревиатура означает питание на расширенном полном пансионе, включая завтрак, обед и ужин (шведский стол), а также подачу напитков (возможно, пива и вина).

Mini all inclusive — полный пансион (завтрак, обед, ужин) с местными напитками, подается в течение дня, но в ограниченном количестве.

ALL , Al (All inclusive) в переводе означает все включено — завтрак, обед и ужин (шведский стол). Во время пребывания в течение дня вы можете пить предложенные безалкогольные и алкогольные напитки в неограниченном количестве, а также практикуются дополнительные формы питания (легкий завтрак, состоящий из булочек, масла, джема, кофе или чая, сока, обеда, легких закусок. , полдник, поздний ужин, шашлык и т. д.).

HCAL (hign class all inclusive) — если в описании номера есть такая аббревиатура, то вы получаете все бесплатно, кроме покупок во время покупок, телефона, врача, парикмахера, некоторых развлечений (водные виды спорта и подводное плавание).

Advanced , UAI (ultra aIl inclusive) — завтрак, поздний завтрак, обед, полдник и ужин (шведский стол). К еде будет добавлен хороший выбор десертов, сладостей, мороженого, всевозможных холодных закусок, напитков местного и зарубежного производства. Некоторые отели, работающие по системе Ultra All Inclusive, могут предлагать гостям дополнительное бесплатное питание в ресторанах с различными национальными кухнями. При этом еда доступна в течение всего дня и включает в себя различные напитки (в том числе алкогольные).Разновидности Ultra AIL в том числе:

  • Elegance all inc
  • Super all inc
  • VIP all inc
  • De luxe all inc
  • Vc all inc
  • MEGA all inc
  • 9000 все вкл.
  • VIP Service
  • Ultra de luxe all inc
  • Royal class all inc
  • Max all inc Extended all inc
  • Exellent all inc
  • Imperial all

Дополнительные формы питания в отелях

CB (Континентальный завтрак) — Континентальный завтрак (можно использовать название «Французский завтрак» (завтрак)).Это легкий завтрак, в который входит кофе (чай), сок, булочки, масло и джем. Обычно такой вид питания предлагается в европейских городских гостиницах. Обычно он состоит из экономичного набора «кофе + круассан», что очень хорошо характеризует эти виды завтрака. У него минимальный выбор, но при дополнительной оплате вам гарантирована значительная экономия.

Ab (Американский завтрак) — Американский завтрак, похожий по меню на континентальный завтрак, предполагает подачу различных нарезок, из горячих блюд подают только омлет с беконом (или сосисками).

EB (английский завтрак) — завтрак, полноценный и сытный завтрак, обычно в меню входят сок, яичница (омлет), тосты, булочки, масло, джем и кофе (чай).

UAI (Ультра все включено) — этот вид питания включает максимальный перечень: завтрак, поздний завтрак, обед, полдник и ужин (шведский стол). Вам будет предложен широкий выбор различных сладостей, десертов, мороженого, всевозможные холодные закуски, местные и импортные напитки.

Практически все работающие и безработные серьезно отдыхают за границей. И это понятно: в году только один отпуск, поэтому я хочу провести свои «каникулы» с большим удовольствием и как можно лучше. Воспоминания об отдыхе согреют вас в будни и дадут силы для плодотворной работы. почему при планировании отпуска важно продумать все детали, чтобы впечатления не испортились никакими неприятностями, которых вы не предвидели. Туроператорам обычно необходимо предупреждать при бронировании номеров в отеле вместе с типами номеров, наличие собственного пляжа и бассейнов, качество обслуживания, различные развлекательные мероприятия, медицина и различные виды питания.Ведь сколько еще осталось свободного времени, если у вас нет постоянной необходимости заниматься добычей «провизии». И, как заметили многие отдыхающие, смена обстановки часто сказывается на усилении голода. Мы познакомим вас с основными видами питания в отеле, в частности с системой питания RO.

Что означает обратное питание?

Дело в том, что для предотвращения разного рода недоразумений между многими туристическими агентствами и туристическими организациями используются различные международные термины и символы.На английском языке есть аббревиатуры, которые характеризуют форму питания (а именно, еда и напитки, которыми накормят путешественников) в отелях. Наиболее популярны такие виды, как AL, HB, UAI, HB и др.

Например, AL — это такой привычный для наших туристов all inclusive, или all inclusive, гарантирующий полный пансион (завтрак, обед, ужин). Аббревиатура UAI (то есть Ultra All inclusive) означает высококачественное четырехразовое питание.

Часто используются обозначения BB (постель + завтрак, то есть только завтрак в отеле), HB (полупансион, или полупансион — завтрак и ужин), FB (полный пансион, или полный пансион — трехразовое питание). .

В отличие от вышеуказанных типов питания в отелях, RO означает «Только номер» и означает, что питание не входит в ваш турпакет. Это означает, что вы можете свободно пользоваться своей комнатой, всеми развлекательными заведениями, включая бассейны, но питаться придется в бистро, кафе или ресторане.

Когда вы заказываете тип питания RO?

Согласитесь, полное отсутствие провизии довольно неудобно и мало кому подходит. Особенно многих не устраивает, например, необходимость утром искать место в многолюдном кафе или ресторане, ведь стоимость еды в самом отеле далеко не низкая и обойдется в кругленькую сумму.Кроме того, нужно знать район, где планируется отдых. Это поможет вам выбрать хорошее кафе с отличной кухней и обслуживанием и не переплачивать «бешеные» деньги. Поэтому такой вид питания в отелях РО — редкость из-за своей непопулярности.

Однако бывают ситуации, когда питание RO все еще заказывается. Это обозначение используется в горящих пакетах, для привлечения туристов с пониженной стоимостью тура. Иногда отдыхающие сами выбирают этот вид питания, потому что либо не доверяют кухне отеля, либо по состоянию здоровья нуждаются в особой диете.

Часто в бронировании гостиничных номеров появляется тип питания RO, когда пакеты заказываются различными учреждениями и компаниями для своих сотрудников при организации конгрессов и конференций. При этом опасения по поводу их кормления ложатся на плечи участников мероприятий. Будьте внимательны при бронировании номеров: помимо обозначения питания в отелях РО, недостаток питания может указываться как БО, АО, ОБ. Но обычно для комфорта отдыхающим рекомендуют выбирать тип питания «все включено» или «ультра все включено».

RO BB HB FB AI UAI — расшифровка типов питания в гостиницах. Питание RO (только номер), RR (стоимость номера), OB (Only Bed), AO (Accommodation Only) такие сокращения в отеле означают проживание в номере без питания. Чаще всего это РО. Питание BB (bed breakfast) означает «ночлег и завтрак», т.е. при проживании в отеле по системе BB предоставляется проживание и завтрак в номере. Завтрак, как правило, предполагается в форме «шведского стола», а обилие блюд зависит от уровня отеля и страны проживания.Например, завтрак по системе BB в Центральной Европе значительно уступает варианту проживания BB в Греции или ОАЭ. Питание HB (полупансион), что в переводе означает «полупансион» — завтрак и ужин. Некоторые дорогие отели предлагают бесплатное шампанское на завтрак. Как правило, питание организовано по системе «шведский стол». Безалкогольные напитки по системе HB — бесплатно; заказ платных алкогольных напитков осуществляется с оплатой на месте или за номер. Питание HB + (полупансион плюс) — это то же самое, что и полупансион, но вариант HB + предоставляет некоторые бесплатные алкогольные напитки, как правило, местного производства.Питание FB (полный пансион) или «полный пансион». Питание: завтрак, обед и ужин — обычно шведский стол. Система FB не предусматривает бесплатный алкоголь, за исключением шампанского на завтрак, в некоторых дорогих отелях. Алкогольные напитки на основе FB доступны на ужин за дополнительную плату. Еда FB + (полный пансион плюс) — аналогична FB, но FB + подразумевает некоторые бесплатные алкогольные напитки, как правило, местного производства. Питание AI (все включено) «все включено», многоразовое питание без ограничений. В зависимости от уровня отеля AI может варьироваться от трехразового питания до многократного в течение дня — рестораны, барбекю, гриль, ночные бары и т. Д.Бесплатные алкогольные напитки местного, реже импортного производства. Импортные алкогольные напитки и коктейли по системе AI бесплатны только в дорогих отелях, в более простых отелях алкогольные напитки импортные за дополнительную плату и при наличии. Питание AIP (all inclusive premium) «all inclusive premium» — редкость. AIP похож на AI, но с большим выбором духов. UAI (ultra all inclusive, UALL) тип питания по системе «ультра все включено» — многократное питание в течение дня, при желании, в ресторанах разных кухонь мира, гриль-барах, ночных барах и т. Д., мороженое в течение дня и сладости. UAI — это бесплатные безалкогольные и алкогольные напитки местного и зарубежного производства.

Отправляясь в отпуск, большинство наших соотечественников ограничиваются самостоятельным выбором страны для путешествия, а специалисты доверяют поиск конкретного курорта, отеля, тура. Чаще всего такие туристы выражают желание получить отдых по системе «все включено». Для этого есть определенная причина, ведь именно туристические агентства обладают наиболее полной информацией и могут предложить вам выбор среди множества городов и отелей.Из возможных вариантов, отвечающих вашим требованиям, вам остается только выбрать лучший. Но зачастую сотрудники турфирм просто не успевают искать эксклюзивный тур, а клиентам предлагают средние стандартные пакеты или, что еще хуже, не очень популярные, «просроченные» путевки. Если вы не очень опытный турист, то рискуете стать обладателем именно такой экскурсии.

Уберечь свой отдых от недобросовестного туроператора не так уж и сложно — для этого нужно хоть немного понимать основные термины на туристическом рынке.И если вы знаете, как указано «все включено» в описании отеля, если вы ориентируетесь на количество «звездочек» отеля и можете отличить Анталию от Аланьи, то обмануть вас не так-то просто.

Более того, в последнее время путешественники все чаще выбирают курорт сами, сравнивают отели и бронируют авиабилеты. В этом нет ничего сложного, но такой подход экономит деньги и вселяет уверенность в правильном выборе. Так что, если вы чувствуете в себе силы стать таким независимым от агентств туристом, наши советы вам помогут.

По сути, пресловутая категория «все включено» уже стала однозначным синонимом комфортного отдыха. Вы можете легко идентифицировать этот тип гостевых домов по аббревиатуре Al (All Inclusive) . Фактически, эти две буквы (или слова) скрывают информацию о том, что во время вашего пребывания в отеле вас будут кормить и поить без каких-либо ограничений в любое время дня и ночи. Что касается алкогольных напитков, то в категорию «все включено» входит алкоголь той страны, в которой вы отдыхаете.Так что, если вы не представляете свой отдых без ажиотажа других мировых брендов, стоит заказать номер на порядок выше. Он будет называться UAl (Ulta All Inclusive) , в переводе на русский язык — примерно «ультра все включено». Иногда эту категорию также называют All Inclusive De Luxe. В отеле этой категории можно не беспокоиться о том, что любимого виски не будет в баре или вам подадут ром от неизвестного производителя.

Как видите, разобраться в иностранных терминах совсем не сложно, сложнее сделать выбор.Ведь заветное «все включено» по умолчанию вовсе не является гарантией полноценного отдыха. Выбирая категорию отеля, ориентируйтесь в первую очередь на свои вкусы и привычки: какой отдых вам нравится? Как планируете провести это время, чем его наполнить? Сколько попутчиков будет с вами и сколько им лет? Ответы дадут вам возможность ориентироваться.

Опытные туристы предполагают, что категория «все включено» идеально подходит для тех, кто мечтает о спокойном, расслабляющем отдыхе.Если ваш идеальный отдых — это ленивое лежание на шезлонге с коктейлем в руке, периодическое плавание в кристально чистом бассейне и спа-процедуры, то обязательно поставьте галочку рядом с фразой «все включено» в описании отеля. На этот вид отдыха стоит обратить внимание тем, кто путешествует с детьми. Так вы убережете себя от забот заранее, чем накормите детей, внезапно проголодавшихся после игр на южном побережье.

Но далеко не все туристы рассчитывают расслабиться в путешествии.Некоторые хотят видеть больше, чем стены отеля, даже спроектированного самым модным дизайнером интерьеров. Если вы такой путешественник, и хотите путешествовать по городу, покидайте отель на несколько часов в день, то платить за круглосуточный гестхаус в вашем случае просто не имеет смысла. Вам больше подойдет так называемый полный пансион, состоящий из завтрака, обеда и ужина. (обозначается FB от английского Full Board) или даже полупансион с завтраком и ужином (обозначается HB — Half Board) .В любом случае считайте свои планы и усилия на прогулки и питание вне отеля.

Все вышеперечисленные рекомендации касаются в основном южных стран, главным развлечением которых остается пляжный отдых с нечастыми экскурсиями по достопримечательностям. Путешествуя по Европе, вы полностью заполните свой отпуск. Скорее всего, ваш день будет состоять из прогулок по городу, а обедать вы предпочтете в кафе и ресторанах, встречающихся по дороге. В этом режиме категория «все включено» в описании отеля не будет выполнять свое предназначение, поэтому лучше предпочесть облегченный вариант размещения, предлагающий гостям только завтрак.Сокращенно BB (Bed & Breakfast) , такой гостевой дом не будет ограничивать ваше передвижение.

В отелях есть и другие виды питания, но они менее востребованы и, соответственно, менее распространены. На горнолыжных курортах и ​​в молодежных хостелах вам предложат особые принципы поселения. Благо современная индустрия туризма предлагает такой широкий выбор, что всегда можно найти подходящий вариант. И не забывайте, что на качество питания влияет не только надпись «все включено» в описании отеля, но и количество звездочек.Чем их больше, тем шире выбор блюд и напитков. И хотя большинство отелей придерживаются единого принципа питания, набор продуктов и ассортимент меню могут существенно различаться даже в пределах одной категории. Будьте внимательны при выборе и наслаждайтесь отдыхом!

BaRTv1.0: улучшенный набор данных эталонных транскриптов ячменя для определения точных изменений транскриптома ячменя с использованием RNA-seq | BMC Genomics

  • 1.

    Alamancos GP, Pagès A, Trincado JL, Bellora N, Eyras E.Использование количественной оценки транскриптов для быстрого вычисления альтернативных профилей сращивания. РНК. 2015; 21: 1521–31.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 2.

    Альтшул С.Ф., Гиш В., Миллер В., Майерс Е.В., Липман Д. Базовый инструмент поиска локального выравнивания. J Mol Biol. 1990; 215: 403–10.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 3.

    Ашуб А., Мюллер Н., Хименес-Гомес Дж. М., Брюггеман В. Заметные изменения транскриптома листьев дикого ячменя в ответ на индивидуальную и комбинированную акклиматизацию к засухе и условия теплового шока. Physiol Plant. 2018; 163: 18–29.

    CAS
    PubMed
    Статья

    Google Scholar

  • 4.

    Bazin J, Romero N, Rigo R, Charon C, Blein T, Ariel F, Crespi M. Ядерные спекл-связывающие РНК белки ремоделируют альтернативный сплайсинг и некодирующий транскриптом Arabidopsis для регулирования перекрестной связи между ауксинами. и иммунные ответы.Фронтальный завод им. 2018; 9: 1209.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 5.

    Bolger AM, Lohse M, Usadel B. Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика. 2014; 30: 2114–20.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 6.

    Брей Н.Л., Пиментел Х., Мельстед П., Пахтер Л. Почти оптимальная вероятностная количественная оценка последовательности РНК.Nat Biotechnol. 2016; 34: 525–7.

    CAS
    PubMed
    Статья

    Google Scholar

  • 7.

    Brown JWS, Calixto CP, Zhang R. Высококачественные эталонные наборы данных транскриптов являются ключом к анализу транскрипт-специфического секвенирования РНК в растениях. Новый Фитол. 2017; 213: 525–30.

    CAS
    PubMed
    Статья

    Google Scholar

  • 8.

    Busch A, Hertel KJ. Расширенное регулирование альтернативного сплайсинга NAGNAG: новые уловки для сплайсосомы? Genome Biol.2012; 13: 143.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 9.

    Calixto CPG, Tzioutziou NA, James AB, Hornyik C, Guo W., Zhang R, Nimmo HG, Brown JWS. Холодозависимая экспрессия и альтернативный сплайсинг длинных некодирующих РНК Arabidopsis. Фронтальный завод им. 2019; 10: 235.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 10.

    Calixto CPG, Guo W., James AB, Tzioutziou NA, Entizne JC, Panter PE, Knight H, Nimmo HG, Zhang R, Brown JWS.Быстрый и динамичный альтернативный сплайсинг влияет на транскриптом холодовой реакции Arabidopsis. Растительная клетка. 2018; 30: 1424–44.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 11.

    Calixto CPG, Simpson CG, Waugh R, Brown JWS. Альтернативный сплайсинг часовых генов ячменя в ответ на низкую температуру. PLoS One. 2016; 11: e0168028.

    PubMed
    PubMed Central
    Статья
    CAS

    Google Scholar

  • 12.

    Capovilla G, Pajoro A, Immink RG, Schmid M. Роль альтернативного сплайсинга пре-мРНК в передаче сигналов температуры. Curr Opin Plant Biol. 2015; 27: 97–103.

    CAS
    PubMed
    Статья

    Google Scholar

  • 13.

    Карвалью РФ, Фейджао К.В., Дуке П. О физиологическом значении альтернативных событий сплайсинга у высших растений. Протоплазма. 2013; 250: 639–50.

    CAS
    PubMed
    Статья

    Google Scholar

  • 14.

    Chamala S, Feng G, Chavarro C, Barbazuk WB. Полногеномная идентификация эволюционно консервативных альтернативных событий сплайсинга у цветковых растений. Фронт Bioeng Biotechnol. 2015; 3:33.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 15.

    Далин Л.С., Вандер Валь Л.Дж., Франковяк Д.Д. Характеристика и молекулярное картирование генов, определяющих полукарликовость ячменя. J Hered. 2005; 96: 654–62.

    CAS
    PubMed
    Статья

    Google Scholar

  • 16.

    Доусон И.К., Рассел Дж., Пауэлл В., Стеффенсон Б., Томас В. Т., Во Р. Барли: трансляционная модель адаптации к изменению климата. Новый Фитол. 2015; 206: 913–31.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 17.

    Dobin A, Gingeras TR. Оптимизация картирования РНК-Seq с помощью STAR. Методы Мол биол. 2016; 1415: 245–62.

    CAS
    PubMed
    Статья

    Google Scholar

  • 18.

    Добин А., Дэвис К.А., Шлезингер Ф., Дренкоу Дж., Залески С., Джа С., Батут П., Шейссон М., Джингерас Т.Р. STAR: сверхбыстрый универсальный выравниватель RNA-seq. Биоинформатика. 2013; 29: 15–21.

    CAS
    PubMed
    Статья

    Google Scholar

  • 19.

    Филичкин S, Priest HD, Megraw M, Mockler TC. Альтернативное сращивание растений: направление движения на перекрестке адаптации и экологического стресса. Curr Opin Plant Biol. 2015; 24: 125–35.

    CAS
    PubMed
    Статья

    Google Scholar

  • 20.

    Энгстрём П.Г., Штайгер Т., Сипос Б., Грант Г.Р., Калес А., Рэтч Г., Голдман Н., Хаббард Т.Дж., Харроу Дж., Гиго Р., Бертоне П., Консорциум RGASP. Систематическая оценка программ сплайсированного выравнивания для данных RNA-seq. Нат методы. 2013; 10: 1185–91.

    PubMed
    PubMed Central
    Статья
    CAS

    Google Scholar

  • 21.

    Gan X, Stegle O, Behr J, Steffen JG, Drewe P, Hildebrand KL, Lyngsoe R, Schultheiss SJ, Osborne EJ, Sreedharan VT, et al.Множественные эталонные геномы и транскриптомы Arabidopsis thaliana. Природа. 2011; 477: 419–23.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 22.

    Guo G, Dondup D, Yuan X, Gu F, Wang D, Jia F, Lin Z, Baum M, Zhang J. Редкий аллель HvLox-1, связанный с активностью липоксигеназы в ячмене (Hordeum vulgare L. ). Theor Appl Genet. 2014; 127: 2095–103.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 23.

    Guo W, Tzioutziou N, Stephen G, Milne I, Calixto C, Waugh R, Brown JWS, Zhang R. 3D RNA-seq — мощный и гибкий инструмент для быстрой и точной дифференциальной экспрессии и анализа альтернативного сплайсинга данных RNA-seq для биологов. bioRxiv. 2019; https://doi.org/10.1101/656686.

  • 24.

    Хаас Б.Дж., Папаниколау А., Яссур М., Грабхер М., Блад П.Д., Боуден Дж., Кугер М.Б., Экклс Д., Ли Б., Либер М., Макманес, доктор медицины и др. Реконструкция последовательности транскрипта de novo из RNA-seq с использованием платформы Trinity для создания и анализа ссылок.Nat Protoc. 2013; 8: 1494–512.

    CAS
    PubMed
    Статья

    Google Scholar

  • 25.

    Hayer KE, Pizarro A, Lahens NF, Hogenesch JB, Grant GR. Сравнительный анализ алгоритмов определения и количественной оценки форм сплайсинга полноразмерной мРНК на основе данных RNA-seq. Биоинформатика. 2015; 31: 3938–45.

    CAS
    PubMed
    PubMed Central

    Google Scholar

  • 26.

    Международный консорциум по секвенированию ячменя.Сборка физической, генетической и функциональной последовательности генома ячменя. Природа. 2012; 491: 711–6.

    Артикул
    CAS

    Google Scholar

  • 27.

    Janiak A, Kwasniewski M, Sowa M, Gajek K, muda K, Kościelniak J, Szarejko I.Не время терять: исследование транскриптома показывает, что устойчивость к засухе ячменя может быть связана с подобными стрессу паттернами экспрессии, которые существуют до возникновения стресса. Фронтальный завод им. 2018; 8: 2212.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 28.

    Калина М., Симпсон К.Г., Сайед Н.Х., Левандовска Д., Маркес И., Кусенда Б., Маршалл Дж., Фуллер Дж., Кардл Л., Макникол Дж., Динь Штаб-квартира, Барта А., Браун Дж. Альтернативный сплайсинг и нонсенс-опосредованный распад модулируют экспрессию важных регуляторных генов у Arabidopsis. Nucleic Acids Res. 2012; 40: 2454–69.

    CAS
    PubMed
    Статья

    Google Scholar

  • 29.

    Ким С.Х., Королева О.А., Левандовска Д., Пендл А.Ф., Кларк Г.П., Симпсон К.Г., Шоу П.Дж., Браун Дж.В.С. Аберрантные транскрипты мРНК и белки нонсенс-опосредованного распада UPF2 и UPF3 обогащены ядрышком Arabidopsis. Растительная клетка. 2009; 21: 2045–57.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 30.

    Кинтлова М., Блавет Н., Цеган Р., Хобза Р. Транскриптом ячменя при трех различных стрессовых реакциях на тяжелые металлы.Данные генома. 2017; 13: 15–7.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 31.

    Laloum T, Martin G, Duque P. Альтернативный контроль сплайсинга реакций на абиотический стресс. Trends Plant Sci. 2018; 23: 140–50.

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 32.

    Lee Y, Rio DC. Механизмы и регуляция альтернативного сплайсинга пре-мРНК.Анну Рев Биохим. 2015; 84: 291–323.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 33.

    Лю Х., Лю Х., Чжоу Л., Чжан З., Чжан Х, Ван М., Ли Х, Лин З. Параллельное одомашнивание гена даты заголовка 1 в зерновых. Mol Biol Evol. 2015; 32: 2726–37.

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 34.

    Marquez Y, Brown JWS, Simpson C, Barta A, Kalyna M.Транскриптомное исследование показывает возросшую сложность альтернативного ландшафта сращивания у Arabidopsis. Genome Res. 2012; 22: 1184–95.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 35.

    Mascher M, Gundlach H, Himmelbach A, Beier S, Twardziok SO, Wicker T, Radchuk V, Dockter C, Hedley PE, Russell J, et al. Конформация хромосомы фиксирует упорядоченную последовательность генома ячменя. Природа. 2017; 544: 427–33.

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 36.

    Мастранджело А.М., Мароне Д., Лайдо Дж., Де Леонардис А.М., Де Вита П. Альтернативный сплайсинг: повышение способности справляться со стрессом через пластичность транскриптома. Plant Sci. 2012; 185-186: 40–9.

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 37.

    Мацумото Т., Танака Т., Сакаи Х., Амано Н., Канамори Х., Курита К., Кикута А., Камия К., Ямамото М., Икава Х и др.Комплексный анализ последовательности 24 783 полноразмерных кДНК ячменя, полученных из 12 библиотек клонов. Plant Physiol. 2011; 156: 20–8.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 38.

    Мризова К., Голаскова Е., Оз М.Т., Йискрова Е., Фреборт И., Галушка П. Трансгенный ячмень: перспективный инструмент для биотехнологии и сельского хозяйства. Biotechnol Adv. 2014; 32: 137–57.

    PubMed
    Статья
    CAS
    PubMed Central

    Google Scholar

  • 39.

    Nilsen TW, Graveley BR. Расширение протеома эукариот путем альтернативного сплайсинга. Природа. 2010; 463: 457–63.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 40.

    Оуян С., Чжу В., Гамильтон Дж., Лин Х, Кэмпбелл М., Чайлдс К., Тибо-Ниссен Ф., Малек Р.Л., Ли Ю., Чжэн Л. и др. 2007. Ресурс TIGR по аннотации генома риса: улучшения и новые функции. Nucleic Acids Res. 35 (выпуск базы данных): D883-7.

    CAS
    PubMed
    Статья

    Google Scholar

  • 41.

    Панахи Б., Мохаммади С.А., Эбрахими Хаксефиди Р., Фаллах Мехрабади Дж., Эбрахими Э. Полногеномный анализ альтернативных событий сплайсинга в Hordeum vulgare: выявление сохранения сплайсинга на основе интронов и его возможной функции с помощью сетевого анализа. FEBS Lett. 2015; 589: 3564–75.

    CAS
    PubMed
    Статья

    Google Scholar

  • 42.

    Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon обеспечивает быструю и достоверную количественную оценку экспрессии транскрипта. Нат методы. 2017; 14: 417–9.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 43.

    Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie обеспечивает улучшенную реконструкцию транскриптома из считываний RNA-seq. Nat Biotechnol. 2015; 33: 290–5.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 44.

    Pham AT, Maurer A, Pillen K, Brien C, Dowling K, Berger B, Eglinton JK, March TJ. Полногеномная ассоциация роста растений ячменя при стрессе засухи с использованием сопоставления популяции вложенных ассоциаций. BMC Plant Biol. 2019; 19: 134.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 45.

    Редди А.С., Маркес Ю., Калина М., Барта А. Сложность альтернативного ландшафта сращивания растений. Растительная клетка. 2013; 25: 3657–83.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 46.

    Ren P, Meng Y, Li B, Ma X, Si E, Lai Y, Wang J, Yao L, Yang K, Shang X, Wang H. Молекулярные механизмы акклиматизации к фосфорному голоданию и восстановления, лежащего в основе полного -Профилирование транскриптома по длине ячменя (Hordeum vulgare L.). Фронтальный завод им. 2018; 9: 500.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 47.

    Рассел Дж., Машер М., Доусон И.К., Кириакидис С., Каликсто С., Фройнд Ф., Байер М., Милн И., Маршалл-Гриффитс Т., Хайнен С. и др. Секвенирование экзома географически разнообразных староместных и диких сородичей ячменя дает представление об адаптации к окружающей среде. Нат Жене. 2016; 48: 1024–30.

    CAS
    PubMed
    Статья

    Google Scholar

  • 48.

    Шиндлер С., Шафрански К., Хиллер М., Али Г.С., Палуса С.Г., Бакофен Р., Платцер М., Редди А.С.Альтернативный сплайсинг на акцепторах NAGNAG в генах, кодирующих SR и SR-связанных белка Arabidopsis thaliana. BMC Genomics. 2008; 9: 159.

    PubMed
    PubMed Central
    Статья
    CAS

    Google Scholar

  • 49.

    Shi Y, Sha G, Sun X. Полногеномное исследование альтернативного сплайсинга NAGNAG у Arabidopsis. Planta. 2014; 239: 127–38.

    CAS
    PubMed
    Статья

    Google Scholar

  • 50.

    Shirasu K, Lahaye T, Tan MW, Zhou F, Azevedo C, Schulze-Lefert P. Новый класс эукариотических цинк-связывающих белков необходим для передачи сигналов устойчивости к болезням у ячменя и развития у C. elegans. Клетка. 1999. 99: 355–66.

    CAS
    PubMed
    Статья

    Google Scholar

  • 51.

    Симпсон К.Г., Фуллер Дж., Маронова М., Калина М., Дэвидсон Д., Макникол Дж., Барта А., Браун Дж. Мониторинг изменений в альтернативном сплайсинге матричной РНК-предшественника в транскриптах нескольких генов.Плант Дж. 2008; 53: 1035–48.

    CAS
    PubMed
    Статья

    Google Scholar

  • 52.

    Sokal RR, Rohlf FJ. Принципы и практика статистики в биологических исследованиях. 3-е изд. Нью-Йорк: У. Х. Фриман; 1995.

    Google Scholar

  • 53.

    Soneson C, Love MI, Patro R, Hussain S, Malhotra D, Robinson MD. Оценка совместимости покрытия стыков для количественной оценки надежности оценок численности стенограмм и каталогов аннотаций.Life Sci Alliance. 2019; 2: e201800175.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 54.

    Staiger D, коричневый JWS. Альтернативный сплайсинг на пересечении биологического времени, развития и стрессовых реакций. Растительная клетка. 2013; 25: 3640–56.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 55.

    Szakonyi D, Duque P.Альтернативный сплайсинг как регулятор раннего развития растений. Фронтальный завод им. 2018; 9: 1174.

    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 56.

    Thatcher SR, Zhou W, Leonard A, Wang BB, Beatty M, Zastrow-Hayes G, Zhao X, Baumgarten A, Li B. Полногеномный анализ альтернативного сплайсинга в Zea mays: ландшафт и генетическая регуляция . Растительная клетка. 2014; 26: 3472–87.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 57.

    Винеман Б.А., Шукла С., Дханасекаран С.М., Чиннайян А.М., Несвижский А.И. Двухпроходное выравнивание улучшает количественную оценку стыка нового сращивания. Биоинформатика. 2016; 32: 43–9.

    CAS
    PubMed

    Google Scholar

  • 58.

    Wu TD, Watanabe CK. GMAP: программа геномного картирования и выравнивания последовательностей мРНК и EST. Биоинформатика. 2005; 21: 1859–75.

    CAS
    PubMed
    Статья

    Google Scholar

  • 59.

    Чжан К., Чжан Х, Ван С., Тан Ц., Чжоу Г., Ли К. Вовлечение альтернативного сращивания в прорастание семян ячменя. PLoS One. 2016a; 11: e0152824.

    PubMed
    PubMed Central
    Статья
    CAS

    Google Scholar

  • 60.

    Zhang Q, Zhang X, Pettolino F, Zhou G, Li C. Изменения в составе полисахаридов клеточной стенки, транскрипции генов и альтернативном сплайсинге у прорастающих эмбрионов ячменя. J. Plant Physiol. 2016b; 191: 127–39.

    CAS
    PubMed
    Статья
    PubMed Central

    Google Scholar

  • 61.

    Zhang R, Calixto CPG, Marquez Y, Venhuizen P, Tzioutziou NA, Guo W., Spensley M, Entizne JC, Lewandowska D, Ten Have S, et al. Высококачественный транскриптом Arabidopsis для точного анализа альтернативного сплайсинга на уровне транскриптов. Nucleic Acids Res. 2017a; 45: 5061–73.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 62.

    Zhang R, Calixto CP, Tzioutziou NA, James AB, Simpson CG, Guo W., Marquez Y, Kalyna M, Patro R, Eyras E, et al. AtRTD — исчерпывающий справочный набор данных транскриптов для точной количественной оценки специфической для транскрипта экспрессии у Arabidopsis thaliana. Новый Фитол. 2015; 208: 96–101.

    CAS
    PubMed
    PubMed Central
    Статья

    Google Scholar

  • 63.

    Zhang XN, Shi Y, Powers JJ, Gowda NB, Zhang C, Ibrahim HMM, Ball HB, Chen SL, Lu H, Mount SM.Анализ транскриптома показывает, что SR45 является нейтральным регулятором сплайсинга и супрессором врожденного иммунитета у Arabidopsis thaliana. BMC Genomics. 2017б; 8: 772.

    Артикул
    CAS

    Google Scholar

  • Антидиабетический розиглитазон ремоделирует транскриптом адипоцитов путем перераспределения транскрипции на энхансеры, управляемые PPARγ

    Genes Dev. 2014 1 мая; 28 (9): 1018–1028.

    , 1, 2, 3, 4, 8 , 4, 5, 8 , 1, 2, 4 1, 2, 4, 6, 7 , 1, 2, 4 , 1, 2, 4 , 4, 6 24 1 и , 2, 3, 4, 5, 9

    Соня Э.Шаг

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Медицинское отделение,

    3 Отделение фармакологии,

    4 Институт диабета, ожирения и обмена веществ,

    Хи-Вунг Лим

    4 Институт диабета, ожирения и метаболизма,

    5 Департамент генетики Медицинской школы Перельмана, Университет Пенсильвании, Филадельфия, Пенсильвания 19104, США;

    Джилл М.Маринис

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Отделение медицины,

    4 Институт диабета, ожирения и метаболизма,

    Андреас Прокеш

    1 Отделение Эндокринология, диабет и метаболизм,

    2 Департамент медицины,

    4 Институт диабета, ожирения и метаболизма,

    6 Институт геномики и биоинформатики,

    7 Институт биохимии , Технологический университет Граца, Грац 8010, Австрия

    Дэвид Дж.Steger

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Медицинское отделение,

    4 Институт диабета, ожирения и метаболизма,

    Сео-Хи Ю

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Департамент медицины,

    4 Институт диабета, ожирения и метаболизма,

    Кён-Чже Вон

    4 Институт диабета и ожирения , and Metabolism,

    5 Департамент генетики Медицинской школы Перельмана Пенсильванского университета, Филадельфия, Пенсильвания 19104, США;

    Митчелл А.Лазар

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Медицинское отделение,

    3 Отделение фармакологии,

    4 Институт диабета, ожирения и обмена веществ,

    5 Департамент генетики Медицинской школы Перельмана Пенсильванского университета, Филадельфия, Пенсильвания 19104, США;

    1 Отделение эндокринологии, диабета и метаболизма,

    2 Отделение медицины,

    3 Отделение фармакологии,

    4 Институт диабета, ожирения и обмена веществ,

    5 Департамент генетики Медицинской школы Перельмана Пенсильванского университета, Филадельфия, Пенсильвания 19104, США;

    6 Институт геномики и биоинформатики,

    7 Институт биохимии, Технологический университет Граца, Грац 8010, Австрия

    8 Эти авторы внесли равный вклад в эту работу.

    Поступило 09.01.2014 г .; Принято к печати 31 марта 2014 г.

    Эта статья цитируется в других статьях в PMC.

    Abstract

    Росиглитазон (роси) является мощным сенсибилизатором к инсулину, но серьезная токсичность ограничила его широкое клиническое применение. Rosi действует как лиганд с высоким сродством к рецептору γ, активируемому пролифератором пероксисом (PPARγ), ядерному рецептору с преобладанием адипоцитов (NR). Классическая модель, включающая связывание лиганда с NR на ДНК, объясняет положительную регуляцию экспрессии генов, но лиганд-зависимая репрессия не совсем понятна.Мы решили эту проблему, изучив прямое влияние rosi на транскрипцию генов с помощью глобального последовательного секвенирования (GRO-seq). Рози-индуцированные изменения транскрипции тела гена были выражены через 10 мин и коррелировали с устойчивыми уровнями мРНК, а также с транскрипцией на близлежащих энхансерах (энхансерные РНК [эРНК]). Активно регулируемые eRNAs возникали почти исключительно в сайтах связывания PPARγ, в которые обработка rosi привлекала коактиваторы, включая MED1, p300 и CBP. Напротив, репрессия транскрипции с помощью rosi включает потерю коактиваторов из сайтов эРНК, лишенных PPARγ и обогащенных другими факторами транскрипции, включая факторы AP-1 и C / EBP.Таким образом, rosi активирует и подавляет транскрипцию с помощью принципиально разных механизмов, которые могут быть использованы для разработки антидиабетических препаратов в будущем.

    Ключевые слова: адипоциты, диабет, розиглитазон, транскрипция, PPARγ, энхансерная РНК. 1994; Тонтоноз и др. 1994a). Это необходимо (Rosen et al.1999) и достаточен (Tontonoz et al. 1994b) для адипогенеза, а также имеет решающее значение для функций зрелых адипоцитов, включая метаболизм липидов, секрецию адипокина и чувствительность к инсулину (Rangwala and Lazar 2004). PPARγ связывается почти с большинством адипогенных генов как гетеродимер с ретиноидным X рецептором (RXR) (Lefterova et al. 2008; Nielsen et al. 2008).

    PPARγ, как и большинство NR, представляет собой лиганд-зависимый фактор транскрипции (TF) (Glass and Rosenfeld 2000). Лиганды с высоким сродством к PPARγ включают тиазолидиндионы (TZD) (Lehmann et al.1995), которые являются лекарствами, повышающими чувствительность к инсулину (Nolan et al. 1994). TZD вносят вклад в сенсибилизацию к инсулину, воздействуя на жировую ткань, регулируя транскрипцию генов как положительно, так и отрицательно. Например, TZD индуцируют инсулино-сенсибилизирующие факторы адипонектин (Maeda et al. 2001) и FGF-21 (Moyers et al. 2007), подавляя экспрессию генов, способствующих инсулинорезистентности, включая TNFα (Hofmann et al. 1994), резистин ( Steppan et al. 2001) и ретинол-связывающий белок 4 (Yang et al. 2005).Самым мощным TZD в клинике является розиглитазон (rosi) (Lehmann et al. 1995), который оказывает стойкое антидиабетическое действие, но, к сожалению, обладает токсичностью, ограничивающей его широкое применение (Kung and Henry 2012; Ahmadian et al. 2013) . Поскольку экспрессия PPARγ в жировой ткани необходима для in vivo системных инсулино-сенсибилизирующих эффектов TZDs (Chao et al. 2000; He et al. 2003), критически важно понять, как связывание rosi с PPARγ модулирует экспрессию генов.

    Связывание rosi с PPARγ приводит к привлечению коактиваторов, включая SRC-1, CBP, p300 и MED1, которые индуцируют экспрессию генов (Westin et al.1998; Гельман и др. 1999; Ge et al. 2002; Bugge et al. 2009 г.). Однако механизм, с помощью которого rosi подавляет транскрипцию, не совсем понятен. В макрофагах исследования указывают на рози-зависимое SUMOylation PPARγ, которое связывается с корепрессором NR (NCoR), чтобы предотвратить индукцию воспалительных генов эндотоксином (Pascual et al. 2005). Однако этот механизм относится только к предотвращению индукции за счет стимуляции толл-подобных рецепторов и не был продемонстрирован на других типах клеток (Huang and Glass 2010).Другой предложенный механизм включает лиганд-зависимое рекрутирование корепрессоров, при котором обработка rosi приводит к рекрутированию корепрессоров CTBP1 и CTBP2 на C / EBPα по неизвестному механизму (Vernochet et al. 2009).

    Связывание лиганда с другими NR было предположено для репрессии экспрессии генов путем привлечения ограничивающих коактиваторов от других TF, тем самым репрессируя эти гены-мишени. Поддержка этой модели конкуренции соактиваторов, часто называемой подавлением, в значительной степени основана на экспериментах по сверхэкспрессии TF в системах трансфекции (Gill and Ptashne 1988; Kelleher et al.1990; Kamei et al. 1996; Fronsdal et al. 1998; Ли и др. 2000; Ли и др. 2000; Kim et al. 2001; Чжан и Дэн 2001; Manna and Stocco 2007; He et al. 2012; Паскуаль-Гарсия и др. 2013), хотя недавнее исследование продемонстрировало перераспределение коактиватора с эндогенными факторами и хроматином в масштабе всего генома в контексте обработанных E2 клеток MCF-7 (He et al. 2012).

    Во многих исследованиях использовался анализ транскриптома, чтобы сделать вывод о влиянии rosi на стабильную экспрессию генов в адипоцитах (Li and Lazar 2002; Sears et al.2007; Choi et al. 2010; Rong et al. 2011). Однако стабильные уровни мРНК определяются скоростью их транскрипции и деградации. Здесь мы впервые непосредственно измерили скорость транскрипции адипоцитов в масштабе всего генома с использованием глобального анализа с последующим секвенированием (GRO-seq) (Core et al. 2008). Мы обнаружили, что rosi быстро активирует или подавляет транскрипцию тысяч генов адипоцитов, и эта регуляция сильно коррелирует с устойчивой регуляцией мРНК. Мы также идентифицировали тысячи двунаправленных межгенных транскриптов, которые соответствуют критериям энхансерных РНК (эРНК) (De Santa et al.2010; Kim et al. 2010), которые, как было показано, маркируют функциональные энхансеры и регулируют транскрипцию ближайшего гена (Kaikkonen et al.2013; Lam et al.2013; Li et al.2013; Melo et al.2013), и демонстрируют, что rosi регулирует Транскрипция эРНК способом, который связан с активацией близлежащих тел генов.

    Rosi-up-регулируемые eRNAs возникали в сайтах сильного связывания PPARγ, с которыми были задействованы коактиваторы, такие как MED1, CBP и p300. Примечательно, однако, что подавление транскрипции эРНК происходит на сайтах, лишенных PPARγ, но обогащенных членами семейства C / EBP и AP-1.MED1 и другие коактиваторы были отклонены в этих сайтах с пониженной регуляцией, что убедительно подтверждает механизм негативной регуляции, включающий перераспределение коактиватора при связывании rosi с PPARγ. Таким образом, анализ регулируемых eRNAs выявляет новый механизм, с помощью которого rosi репрессирует транскрипцию гена адипоцитов на эндогенных уровнях PPARγ и других TF в масштабе всего генома.

    Результаты

    Rosi быстро и надежно регулирует транскрипцию генов в адипоцитах

    GRO-seq (Core et al.2008; Wang et al. 2011) использовали для измерения транскрипции растущего гена в адипоцитах 3T3-L1 мышей и после обработки rosi в течение 10 мин, 30 мин, 1 час и 3 часа. Локус Fabp4, классическая мишень гена PPARγ адипоцитов (Spiegelman and Green 1980; Rival et al. 2004), показал повышенную транскрипцию при обработке rosi (). Напротив, транскрипция тела гена Rgs2 быстро репрессируется с помощью rosi (), что согласуется с поведением мРНК (Sears et al. 2007). В целом, аннотированные в 1951 г. гены RefSeq транскрипционно регулировались rosi в один или несколько тестируемых моментов времени ().Интересно, что 71% регулируемых растущих транскриптов были репрессированы, тогда как только 29% были активированы rosi.

    Рози быстро увеличивает и подавляет транскрипцию генов в адипоцитах. GRO-seq выполняли на зрелых адипоцитах 3T3-L1, обработанных rosi в течение 0, 10, 30, 1 или 3 часов. (A) Повышенная транскрипция в локусе Fabp4 при обработке rosi. (B) Ген Rgs2 демонстрирует подавленную транскрипцию после обработки rosi. (C) Тепловая карта показывает 1951 ген, которые показали значительное изменение транскрипции (коэффициент ложного обнаружения [FDR] <0.05) из-за обработки rosi по крайней мере в один момент времени.

    Регуляция транскрипции растущего гена с помощью rosi коррелирует с изменениями уровней мРНК. 1 ч, 2 ч, 6 ч, 12 ч, 24 ч, 36 ч и 48 ч обработки rosi, с тремя биологическими повторами в каждый момент времени (). В то время как зарождающаяся транскрипция многих генов регулировалась уже через 10 и 30 минут после rosi, очень немногие транскрипты мРНК изменялись в течение этого периода времени и, по крайней мере, в течение 2 часов после обработки rosi.Это неудивительно, поскольку время, необходимое для достижения новых стабильных уровней, связано со скоростью разложения, а не со скоростью синтеза (Schimke and Doyle 1970). Однако корреляция между зарождающейся транскрипцией и устойчивым уровнем мРНК была высокой в ​​более поздние моменты времени, причем наибольшая корреляция отмечена между регуляцией транскрипции через 3 часа и регуляцией мРНК, измеренной через 6 часов после розыгрыша. Более низкая корреляция с более поздними временными точками микроматрицы предполагает, что установившаяся регуляция в эти более поздние сроки может зависеть от вторичных транскрипционных изменений, происходящих позже, чем через 3 часа лечения.Важно отметить, что прямая регуляция транскрипции с помощью rosi в этой модели была очень похожа на недавно опубликованную регуляцию экспрессии генов жировой ткани in vivo у мышей, получавших rosi, что позволяет предположить, что многие из описываемых rosi-зависимых изменений имеют физиологическое значение (дополнительный рисунок S1). ; Оно и др. 2012).

    Уровни транскрипции гена адипоцитов в теле коррелируют с устойчивыми уровнями мРНК. Корреляция между уровнями мРНК микроматрицы и уровнями транскрипции GRO-seq нанесена на график для каждой временной точки.Коэффициент корреляции Пирсона указан для каждой пары временных точек.

    Rosi регулирует транскрипцию эРНК, которая коррелирует с транскрипцией гена

    Помимо транскрипции тела гена, GRO-seq выявила надежные двунаправленные транскрипты в энхансерах или эРНК (Core et al. 2008; Kim et al. 2010), которые были идентифицированы и количественно в объективном анализе всего генома (). Например, двунаправленные eRNAs были идентифицированы в энхансерах выше локуса Fabp4, и их транскрипция, как наблюдали, регулируется rosi ().Действительно, беспристрастный вызов de novo двунаправленных межгенных транскриптов подтвердил, что транскрипция многих eRNAs сильно и быстро регулируется rosi, а количество подавляемых eRNAs значительно превышает количество eRNA, регулируемых с помощью повышенного уровня (). Это было похоже на влияние rosi на транскрипцию тела гена, и, как наблюдалось в других системах (De Santa et al. 2010; Kim et al. 2010), влияние rosi на транскрипцию eRNA сильно коррелировало с транскрипцией в близлежащие генные тела (; Supplemental Fig.S2A). Корреляция была подтверждена в парах тельца эРНК / ген с помощью количественной ПЦР (кПЦР), которая также продемонстрировала, что индукция эРНК часто предшествовала индукции гена (; дополнительный рисунок S2B). Корреляция была подтверждена и на репрессированных парах эРНК / ген (дополнительный рис. S2C). Хотя внутригенные эРНК были исключены из последующего анализа из-за трудностей с их надежной идентификацией, мы заметили, что многие из них следуют аналогичному паттерну корреляции с целевым геном (дополнительный рис.S3).

    Транскрипция эРНК адипоцитов стимулируется rosi и коррелирует с транскрипцией тела гена. (A) Средний сигнал по всему геному межгенных двунаправленных транскриптов в необработанных адипоцитах от положительной и отрицательной цепей. (B) Две двунаправленные эРНК транскрибируются на энхансерах выше Fabp4 TSS и активируются обработкой rosi. Центры эРНК указаны стрелками. (C) Тепловая карта, показывающая все rosi-регулируемые эРНК, обнаруженные беспристрастным образом (N = 2251). (D) Корреляция между rosi-регулируемыми eRNAs и регуляцией соседнего гена для всех пар совпадающих временных точек (N = 462).Для каждого гена в анализ были включены эРНК в пределах 100 т.п.н. от TSS. (E) Корреляция между регуляцией rosi гена и eRNA, измеренная с помощью RT-qPCR для двух примеров генов, Fabp4 и Pdk4. N = 3. Планки погрешностей указывают на SEM.

    PPARγ непосредственно опосредует индукцию эРНК и транскрипцию гена с помощью rosi

    Анализ de novo нахождения мотивов в сайтах rosi-индуцированных эРНК выявил сильное обогащение последовательности, которая очень похожа на канонический сайт связывания PPARγ / RXR (; Дополнительный рис.S4). В самом деле, повышенная регуляция эРНК с высокой вероятностью должна иметь связанный PPARγ поблизости (85%), гораздо больше, чем нерегулируемые или пониженно регулируемые эРНК (). Фактически, подавляемые eRNAs были относительно лишены связывания PPARγ, как обсуждается ниже. Кроме того, сильное связывание PPARγ, измеряемое общим нормализованным количеством меток из иммунопреципитации хроматина (ChIP) в сочетании с глубоким секвенированием (ChIP-seq), было обогащено активированной эРНК, но не подавленной эРНК, по сравнению с нерегулируемыми эРНК (2). Сайты связывания PPARγ, которые перекрываются с эРНК, имеют более высокую занятость PPARγ, чем те, в которых отсутствует эРНК, что дополнительно указывает на то, что энхансеры с эРНК с большей вероятностью будут функциональными (дополнительный рис.S5). Более того, нокдаун PPARγ аннулировал базальную транскрипцию эРНК в сайтах, регулируемых rosi-up (; дополнительный рис. S6), указывая на то, что связывание PPARγ необходимо для транскрипции эРНК на этих сайтах.

    Роси-регулируемые эРНК зависят от геномного связывания PPARγ. (A) Лучший результат поиска мотивов Гомера de novo на активируемых эРНК. Ближайший известный мотив, мотив DR1, показан для справки. Обогащение этого мотива составляло 45% на целевых сайтах и ​​13,5% на фоновых сайтах.(B) Процент активированных, подавленных и нерегулируемых сайтов эРНК, которые перекрываются с так называемым пиком PPARγ из ChIP-seq. В нашем наборе данных было 14 604 пика PPARγ. Среди них 5819 сайтов были экстрагенными, а 3642 сайта имели эРНК. (C) Общее количество тегов PPARγ в считываниях на миллион (об / мин) в пределах 1 т.п.н. от сайтов эРНК с повышенной, пониженной и нерегулируемой регуляцией. (*) P = 7,7 × 10 −95 по сравнению с нерегулируемым; (**) P = 1,8 × 10 −20 по сравнению с нерегулируемым. (D) ОТ-КПЦР эРНК через 24 часа после нокдауна миРНК PPARγ.N = 3. Планки погрешностей указывают на SEM. (E) Расстояние от TSS до ближайших сайтов PPARγ для регулируемых генов. P <10 −10 для сайтов с повышенной и нерегулируемой регуляцией по критерию χ 2 . (F) Количество сайтов связывания PPARγ в пределах 100 т.п.н. от TSS для регулируемых генов. P <10 −10 для сайтов с повышенной и нерегулируемой регуляцией по критерию χ 2 .

    Помимо регуляции eRNAs, связывание PPARγ также имеет решающее значение для регуляции транскрипции генного тела. Гены с повышенной регуляцией были статистически значимо обогащены сайтами PPARγ, расположенными ближе к сайту начала транскрипции (TSS), по сравнению с генами с пониженной регуляцией или нерегулируемыми генами ().Кроме того, активированные гены имели значительно больше сайтов связывания PPARγ в пределах 100 т.п.н. от TSS (). Вместе эти данные убедительно подтверждают модель, согласно которой rosi активирует экспрессию генов путем связывания с PPARγ на сайтах энхансеров, проксимальных к TSS, где он непосредственно стимулирует эРНК, а также транскрипцию тела гена.

    Репрессия транскрипции eRNA с помощью rosi не опосредуется непосредственно PPARγ

    В отличие от повышающей регуляции транскрипции с помощью rosi, мотив PPARγ и сила связывания не были увеличены на rosi-репрессированных eRNA.Хотя 23,6% эРНК с пониженной регуляцией имели связывание с PPARγ (), этот процент был намного меньше, чем у нерегулируемых эРНК, и связывание, как правило, было чрезвычайно слабым (). Кроме того, в отличие от его действия на эРНК с повышенной регуляцией, нокдаун PPARγ не влияет на базальную экспрессию эРНК с пониженной регуляцией rosi (2). Более того, в отличие от генов с повышенной регуляцией, количество, сила и близость связывания PPARγ не были увеличены рядом с TSS генов с пониженной регуляцией по сравнению с неизмененными генами (). Вместе эти данные убедительно указывают на то, что PPARγ не опосредует репрессию eRNA и транскрипцию тела гена непосредственно rosi; я.е. путем связывания в цис-форме с телом регулируемого гена, как это имело место в большинстве эРНК, регулируемых rosi.

    Анализ мотивов De novo сайтов с подавленной эРНК дал два высокообогащенных мотива, которые больше всего напоминали гибридный мотив C / EBP: AP-1 и канонический мотив AP-1 (; дополнительный рисунок S7). Анализ ChIP-seq для факторов C / EBP и AP-1, которые присутствуют в изобилии в адипоцитах, выявил значительное обогащение подавляемых эРНК как C / EBPα, так и FOSL2 (), которые, как было показано, играют роль в экспрессии генов адипоцитов (Wrann и другие.2012). Более высокий процент эРНК с пониженной регуляцией по сравнению с активированной и нерегулируемой, имел связанные C / EBPα и FOSL2, и, что интересно, хотя было показано, что C / EBPα, как было показано, обогащен рядом с генами, репрессированными после обработки rosi (Vernochet et al. 2009; Haakonsson et al.2013), обогащение было выше для FOSL2 (). Другие протестированные факторы, включая C / EBPβ, ATF2 и JUND, также показали обогащение эРНК с пониженной регуляцией (дополнительный рис. S8), и сила этого связывания не изменилась после обработки rosi (дополнительный рис.S9). Обнаружение того факта, что оба фактора C / EBP и все три фактора AP-1 обогащены в сайтах с пониженной регуляцией, предполагает, что каждый из этих факторов, потенциально вместе с другими TF, но особенно не PPARγ, расположен в эРНК в цис-гене с тельцами генов, транскрипция которых отрицательно регулируется rosi.

    Обогащение факторов C / EBP и AP-1 при подавлении эРНК. (A) Два лучших результата поиска мотивов Гомера de novo в подавляемых эРНК. Ближайший известный мотив для каждого показан для справки.(B) Общее количество меток C / EBPα и FOSL2 в считываниях на миллион (об / мин) в пределах 1 т.п.н. от центра регулируемых эРНК из ChIP-seq. (*) P = 4,6 × 10 -8 по сравнению с нерегулируемым; (**) P = 8,9 × 10 -46 по сравнению с нерегулируемым. (C) Процент регулируемых эРНК, которые перекрываются с пиками C / EBPα или FOSL2.

    Rosi перераспределяет связывание коактиватора MED1 с эРНК с пониженной регуляцией на эРНК с повышенной регуляцией

    Большая часть повышающей регуляции эРНК произошла через 10 мин после добавления rosi, тогда как количество эРНК с пониженной регуляцией было заметно меньше в то время достигло пика через 1 час ().Учитывая прямую природу rosi-регуляции активируемых eRNAs посредством PPARγ, мы предположили, что отсроченная даун-регуляция может быть связана с перераспределением коактиватора на связанный с rosi PPARγ. ChIP-seq для общего коактиватора MED1 выполняли в присутствии и в отсутствие rosi. Затем мы определили сайты занятости MED1, которые содержали эРНК, и были ли эти эРНК активированы или подавлены с помощью rosi (). Как и ожидалось, привлечение MED1 к сайтам связывания PPARγ на активируемых эРНК увеличивалось с помощью rosi ().

    Перераспределение геномной занятости MED1 после обработки rosi. (A) Количество эРНК с повышенной или пониженной регуляцией в каждый момент времени. (B) Рабочий процесс для идентификации сайтов связывания MED1 с регулируемыми эРНК. (C) График разброса, сравнивающий силу связывания MED1 в считываниях на миллион (об / мин) с и без обработки rosi в течение 1 часа, с сайтами, содержащими активированную эРНК, выделенными красным. (D) График разброса, сравнивающий силу связывания MED1 с обработкой rosi в течение 1 часа и без нее, с участками, содержащими подавленную эРНК, выделенными синим цветом.(E) MED1 ChIP-qPCR на сайтах с активированной или подавленной эРНК. N = 5. Планки погрешностей указывают на SEM. (*) P <0,05; (**) P <0,01; (***) P <0,005 по парному t-критерию. (F) График в виде прямоугольника, показывающий среднее изменение занятости MED1 по всему геному после обработки rosi в сайтах регулируемых эРНК. (**) P <10 −15 .

    Примечательно, что 1 час обработки rosi снизил рекрутирование MED1 в сайтах подавления транскрипции эРНК, несмотря на общее отсутствие PPARγ на этих сайтах (). Эти результаты были подтверждены в нескольких репрезентативных сайтах эРНК с повышенной и пониженной регуляцией с помощью MED1 ChIP-qPCR (), а также с помощью независимой репликации ChIP-seq (дополнительный рис.S10). В среднем, после обработки rosi, рекрутирование MED1 значительно снижалось в подавляющих эРНК и увеличивалось в активируемых эРНК по сравнению с нерегулируемыми эРНК (2). Более того, при ограничении эРНК только со связыванием MED1, связывание факторов C / EBP и AP-1 в сайтах эРНК с пониженной регуляцией демонстрирует более значительное обогащение по сравнению с нерегулируемыми сайтами эРНК (дополнительный рисунок S11). Поскольку PPARγ был заметно обогащен в сайтах активируемых эРНК, эти данные вместе указывают на то, что связывание rosi с PPARγ перераспределяет связывание MED1 с сайтов негативно регулируемых эРНК на сайты позитивно регулируемых эРНК.Таким образом, связывание rosi с PPARγ непосредственно активировало транскрипцию эРНК в сайтах с повышенной регуляцией, и в результате перераспределение коактиватора приводило к подавлению транскрипции эРНК, опосредованной другими TF в сайтах, не связанных с PPARγ.

    В подтверждение этого, в меньшинстве эРНК с пониженной регуляцией, где наблюдалось связывание PPARγ, сила связывания PPARγ была заметно снижена по сравнению с сайтами с повышенной регуляцией (дополнительный рис. S12A). Кроме того, в отличие от связанных с PPARγ активированных эРНК (но согласующихся с несвязанными с PPARγ эРНК с пониженной регуляцией), нокдаун PPARγ существенно не изменяет базальную транскрипцию эРНК на этих регулируемых эРНК (дополнительный рис.S12B), что указывает на то, что слабосвязанный PPARγ не функционирует. В соответствии с этим обработка rosi приводила к потере MED1 в этих сайтах (Supplemental Fig. S12C), как это было отмечено для эРНК с пониженной регуляцией, лишенных связывания PPARγ. Базальная величина связывания MED1 с неизмененными eRNAs существенно не отличалась от eRNA с пониженной регуляцией (Supplemental Fig. 13). Причина этого не ясна, но предположительно дополнительные факторы, потенциально включая гистоновые метки или взаимодействующие TF, могут быть вовлечены в определение того, какие эРНК будут подавляться при лечении rosi.

    Более того, перераспределение коактиватора на сайты с повышенной регуляцией и от репрессированных сайтов не ограничивалось только MED1. ChIP-seq для коактиваторов CREB-связывающего белка (CBP) и p300 в присутствии и в отсутствие rosi продемонстрировал умеренное, но последовательное и статистически значимое перераспределение при обработке rosi, аналогичное MED1 (дополнительный рис. S14). Эти данные подтверждают модель, согласно которой после обработки rosi коактиваторы перераспределяются на сильные функциональные сайты PPARγ и от энхансеров, содержащих слабосвязанные PPARγ и другие TF.Удивительно, но мы не наблюдали значительных изменений в h4K27ac в сайтах эРНК, регулируемых через 1 час обработки rosi, хотя мы не можем исключить изменений в метках хроматина в более поздние моменты времени (дополнительный рисунок S15). Кроме того, в отличие от трех испытанных коактиваторов, обработка rosi не вызывала глобального перераспределения NCoR (дополнительный рисунок S16).

    Обсуждение

    Настоящий анализ того, как rosi влияет на скорость транскрипции всего генома в адипоцитах, многое показал о механизмах действия этого антидиабетического лиганда PPARγ.Эти исследования обеспечивают более высокое разрешение и более динамичный портрет транскрипции гена, регулируемого rosi, чем это было возможно ранее. В более ранних сообщениях об экспрессии генов, регулируемых rosi, с использованием микроматрицы или РНК-полимеразы II ChIP-seq было обнаружено несколько сотен регулируемых генов, причем половина или чуть более половины из них активируются rosi (Choi et al.2010; Haakonsson et al. 2013). Напротив, мы обнаружили, что транскрипция регулируется почти в 2000 генных телах, более двух третей из которых репрессируются в ответ на обработку лигандом.Мы полагаем, что эта повышенная чувствительность возникает из-за техники GRO-seq, а также из использования нескольких временных точек для захвата различной динамики прямой регуляции транскрипции.

    Rosi регулирует транскрипцию зарождающегося гена в течение 10 минут после лечения, и это хорошо коррелирует с устойчивой регуляцией мРНК. Как и ожидалось, корреляция задерживается, поскольку изменения в транскрипции тела гена предшествуют изменениям транскрипции мРНК и потому, что время достижения нового стабильного уровня мРНК не зависит от скорости синтеза и зависит исключительно от периода полужизни мРНК (Schimke и Дойл 1970).Корреляция между ранними скоростями транскрипции и устойчивыми уровнями мРНК в более поздние моменты времени ослабевает, предположительно из-за вторичных эффектов rosi, таких как индукция других TF или систем, разрушающих мРНК.

    эРНК представляют большой интерес, поскольку было показано, что они вносят вклад в функцию энхансера и влияют на транскрипцию в теле гена-мишени (Kaikkonen et al.2013; Lam et al.2013; Li et al.2013; Melo et al.2013). ). Нам удалось обнаружить эРНК адипоцитов, и количественная оценка их базальной и регулируемой розами скорости транскрипции выявила высокую корреляцию между транскрипцией эРНК и транскрипцией в соседних генах.В eRNA, регулируемых rosi вверх, связывание PPARγ было сильно обогащено и фактически было необходимо для транскрипции eRNA. Повышение регуляции транскрипции с помощью rosi коррелировало с привлечением коактиваторов MED1, CBP и p300 к сайту транскрипции эРНК, что согласуется с недавним исследованием, которое обнаружило, что MED1 рекрутируется в сайты связывания PPARγ (Haakonsson et al. 2013). ). Повышению регуляции транскрипции генов с помощью rosi также способствовало количество, сила и близость сайтов связывания PPARγ относительно TSS.Таким образом, активация транскрипции гена с помощью rosi соответствует общей модели функции NR, в которой связывание лиганда облегчает рекрутирование коактиваторов PPARγ, связанных цис с регулируемым телом гена. Сайт связывания PPARγ функционирует как энхансер, генерируя эРНК, которые коррелируют с уровнем транскрипции генного тела. Эффект является наибольшим, когда несколько событий сильного связывания PPARγ происходят в относительно непосредственной близости от TSS.

    Напротив, эРНК с пониженной регуляцией rosi совершенно разные.В них отсутствует связывание PPARγ по сравнению с фоновыми уровнями, но они обогащены другими TF, особенно членами семейств TF C / EBP и AP-1. Эти еРНК не зависели от экспрессии PPARγ, что дополнительно указывает на отсутствие прямой роли PPARγ в их транскрипции. Тем не менее, несмотря на то, что PPARγ не связывается поблизости, обработка rosi приводит к удалению коактиваторов из этих сайтов. Это предполагает, что первичный механизм rosi-зависимой репрессии транскрипции включает подавление основных коактиваторов энхансерами, лишенными PPARγ.В соответствии с этим индукция PPARγ-зависимых, rosi-индуцированных эРНК предшествовала подавлению не-PPARγ-зависимых эРНК.

    В отличие от энхансеров с повышенной регуляцией, которые зависят от активации PPARγ и привлечения коактиваторов, таких как MED1, сайты с пониженной регуляцией, в которых было потеряно связывание MED1, были обогащены TF, отличными от PPARγ. Это предполагает, что в принципе любой TF, управляющий транскрипцией на PPARγ-независимом энхансере, будет восприимчив к репрессивным эффектам rosi-коактиваторов, перераспределяющих PPARγ.В самом деле, это может объяснить, почему подавленные энхансеры обогащены для связывания множества факторов, включая C / EBPα, C / EBPβ, FOSL2, ATF2 и JUND. Из них только C / EBPα ранее участвовал в rosi-опосредованной репрессии транскрипции (Vernochet et al. 2009; Haakonsson et al. 2013), и, в частности, в наших исследованиях, C / EBPα был менее обогащен в сайтах с пониженной регуляцией относительно к ТФ АП-1.

    Ранее предполагалось, что роль перераспределения или подавления коактиватора объясняет репрессию транскрипции NR, но большинство этих исследований проводилось с использованием трансфекции для сверхэкспрессии рецепторов или коактиваторов и использования репортерных генов в качестве считывающих значений (Kamei et al.1996; Fronsdal et al. 1998; Ли и др. 2000; Ли и др. 2000; Kim et al. 2001; Чжан и Дэн 2001; Manna and Stocco 2007; He et al. 2012; Паскуаль-Гарсия и др. 2013). Эта модель получила дополнительную поддержку недавно с доказательствами, что эндогенный коактиватор NCOA3 теряется из участков пониженной гиперчувствительности к DNase I после лечения гормоном E2 в клетках MCF-7 (He et al. 2012). Здесь наш анализ эРНК позволил нам сосредоточиться на регулируемых энхансерах и исследовать этот механизм в контексте эндогенного генома и ТФ в адипоцитах, где единственной манипуляцией была обработка лигандом PPARγ, и связать перераспределение коактиватора с изменениями уровней транскрипции. как эРНК, так и генов.

    В макрофагах модель трансрепрессии стала основным механизмом для объяснения PPARγ-опосредованной репрессии генов (Glass and Saijo 2010). В этой модели лечение rosi вызывает SUMOylation и последующее связывание связанного PPARγ с промоторами воспалительных генов, уже связанных с NF-κB и др. Факторами, блокируя удаление корепрессорного комплекса из этих сайтов (Pascual et al. 2005). Однако это было продемонстрировано только на избранных промоторах воспалительных генов и относится только к роли rosi в блокировании активирующего действия эндотоксина.Следовательно, это, вероятно, не объясняет большую часть полногеномной репрессии транскрипции. Следует отметить, что модель трансрепрессии требует связывания PPARγ, хотя и с помощью модели привязки, тогда как мы наблюдали, что большинство эРНК, подавляемых rosi, в адипоцитах фактически лишены PPARγ.

    Таким образом, наше исследование транскрипции зарождающихся генов в адипоцитах не только выявило быстрый транскрипционный ответ на rosi, который предшествует, но сильно коррелирует с устойчивыми уровнями мРНК, но также продемонстрировало, что rosi регулирует eRNA адипоцитов способом, который сильно коррелирован. с транскрипцией тела гена.Биоинформатический, геномный и генетический анализ этих эРНК предоставил убедительные доказательства того, что rosi-зависимая активация и репрессия транскрипции опосредуются двумя принципиально разными механизмами: активация происходит в сайтах связывания PPARγ, а репрессия происходит в сайтах, которые в основном активируются другими TF, рекрутирование коактиватора которых дестабилизируется, когда rosi связывается с PPARγ и увеличивает его сродство к коактиваторам. Адипоциты экспрессируют PPARγ на очень высоком уровне, что, вероятно, способствует как силе связывания PPARγ на р-роси-регулируемых eRNAs, так и перераспределению коактиваторов от других TF в условиях активации PPARγ лигандом.

    Материалы и методы

    Культура клеток

    Клетки 3T3-L1 были получены из Американской коллекции типовых культур и выращены в среде DMEM (Invitrogen) с добавлением 10% фетальной бычьей сыворотки (Tissue Culture Biologics), 100 Ед / мл пенициллина и 100 ед. / Мл пенициллина. мкг / мл стрептомицина (Invitrogen). Через два дня после слияния добавляли среду для дифференцировки (питательная среда с 1 мкМ дексаметазона, 10 мкг / мл человеческого инсулина и 0,5 мМ 3-изобутил-1-метилксантина [Invitrogen]). Клетки дифференцировали, как описано ранее (Lefterova et al.2008) путем роста в среде для дифференцировки в течение 2 дней, затем в среде для выращивания с инсулином в течение 2 дней, а затем только в среде для выращивания. По показаниям зрелые адипоциты 3T3-L1 обрабатывали 1 мкМ rosi (Biomol), растворенным в ДМСО.

    Анализ экспрессии гена

    РНК выделяли из клеток с использованием TRIzol (Invitrogen), а затем мини-набора RNeasy (Qiagen). ОТ-ПЦР выполняли с использованием 1 мкг РНК (Applied Biosystems) в соответствии с инструкциями производителя, а qPCR выполняли с использованием праймеров, перечисленных в дополнительной таблице S1, с использованием мастер-микса Power SYBR Green (Applied Biosystems) на приборах PRISM 7500 и 7900HT (Applied Biosystems ).Анализ проводили с использованием метода стандартных кривых, и все гены были нормализованы по гену домашнего хозяйства Arbp. Для микрочипа целостность РНК проверяли с помощью биоанализатора Agilent 2100. Образцы РНК (150 нг) с числом целостности РНК> 7 использовали для амплификации и маркировки мишеней с помощью набора Ambion WT Expression (№ 4411974) и набора Affymetrix WT Terminal-Labeling (№ 1) в соответствии с протоколом производителя. Планшеты с матрицами Mouse Gene 1.1 ST (№

    8, Affymetrix) использовали для гибридизации микрочипов, отмывки, окрашивания и сканирования с помощью наборов для окрашивания Hyb-Wash-окрашивания GeneTitan (№

    2, Affymetrix) и прибор GeneTitan. Данные сканера GeneTitan были собраны с параметрами по умолчанию и далее проанализированы с использованием пакета геномики Partek. Данные были нормализованы с использованием метода устойчивого многокристального среднего (RMA) по умолчанию. Для каждого гена было взято среднее значение по повторам для сравнительного анализа с уровнем транскрипции гена GRO-seq.

    Получение библиотеки GRO-seq

    GRO-seq выполняли, как описано ранее (Core et al. 2008; Wang et al. 2011).Клетки дважды промывали ледяным PBS и затем набухали в буфере для холодного набухания (10 мМ Трис при pH 7,5, 2 мМ MgCl 2 , 3 мМ CaCl 2 ) в течение 5 минут на льду. Клетки соскребали и центрифугировали при 400 g в течение 10 минут, ресуспендировали в 10 мл буфера для лизиса (буфер для набухания с 10% глицерином, 1% Igepal) и инкубировали в течение 5 минут на льду. Ядра дважды промывали буфером для лизиса и затем ресуспендировали в буфере для замораживания (50 мМ Трис при pH 8,3, 40% глицерин, 5 мМ MgCl 2 , 0.1 мМ ЭДТА). Ядра подсчитывали и осаждали, и 5 × 10 6 ядер ресуспендировали в 100 мкл замораживающего буфера. Для каждой библиотеки анализ проводили на четырех пробирках по 5 × 10 6 ядер.

    Для анализа клетки смешивали с равным объемом буфера для анализа (10 мМ Трис при pH 8,0; 5 мМ MgCl 2 ; 1 мМ DTT; 300 мМ KCl; 20 Ед СУПЕРАзы-In; 1% саркозила; 500 мкМ АТФ, GTP и Br-UTP; 2 мкМ CTP) предварительно нагревали до 30 ° C и инкубировали в течение 5 мин при 30 ° C. Ядерную РНК экстрагировали TRIzol (Invitrogen) и хлороформ и осаждали NaCl и этанолом в течение ночи.Осадок РНК ресуспендировали в воде и РНК обрабатывали ДНКазой (Ambion) в течение 30 мин. РНК гидролизовали с использованием реагентов для фрагментации (Ambion) в течение 13 мин при 70 ° C и очищали на колонке Micro Bio-Spin p-30 (Bio-Rad) в соответствии с инструкциями производителя. РНК инкубировали с 1,5 мкл полинуклеотидкиназы Т4 (New England Biolabs) в течение 1 часа при 37 ° C, а затем с дополнительным 1 мкл еще в течение 1 часа. РНК денатурировали в течение 5 мин при 65 ° C.

    Гранулы агарозы против BrU (Santa Cruz Biotechnology) вращали в течение 1 ч в блокирующем буфере (0.5 × SSPE, 1 мМ EDTA, 0,05% Tween-20, 0,1% PVP, 1 мг / мл BSA). Промежуточную РНК вращали с шариками в течение 1 ч, затем дважды промывали по 5 мин в связывающем буфере (0,5 × SSPE, 1 мМ EDTA, 0,05% Tween-20), дважды в буфере с низким содержанием соли (0,2 × SSPE, 1 мМ EDTA, 0,05% Tween-20), один раз в буфере с высоким содержанием соли (0,5 × SSPE, 1 мМ EDTA, 0,05% Tween-20, 150 мМ NaCl) и дважды в буфере TET (TE при pH 7,4, 0,05% Tween -20). Меченную BrU РНК элюировали с шариков четыре раза в течение 15 мин 100 мкл буфера для элюции, предварительно нагретого до 42 ° C.РНК осаждали этанолом в течение ночи.

    Осадок РНК ресуспендировали в воде, денатурировали и обрабатывали поли (A) -полимеразой (New England Biolabs) в течение 30 минут при 37 ° C. Синтез кДНК выполняли, как описано ранее (Wang et al. 2011), с использованием праймера oNTI223 (5′-pGATCGTCGGACTGTAGAACTCT; CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTTVN-3 ‘), где «p» представляет собой 5’ фосфорирование; представляет собой базовый фуран dSpacer, а «VN» представляет собой вырожденные нуклеотиды. Реакционную смесь обрабатывали 3 мкл экзонуклеазы I (Fermentas) в течение 15 мин при 37 ° C, затем 2 мкл 1 М NaOH в течение 20 мин при 98 ° C и нейтрализовали 1 мкл 2 М HCl.кДНК обрабатывали на 10% геле ТВЕ-мочевина, и продукты вырезали и элюировали с измельченных кусочков геля в течение 4 ч в ТЕ + 0,1% твин и осаждали в этаноле в течение ночи.

    Первая цепь кДНК была подвергнута циркуляризации в течение 1 ч с помощью CircLigase (Epicenter), денатурирована в течение 10 мин при 80 ° C и повторно линеаризована с помощью APE I (New England Biolabs). Релинеаризованную ДНК амплифицировали с помощью ПЦР с использованием набора Phusion Hot Start II, в соответствии с инструкциями производителя, с праймерами oNTI200 (5′-CAAGCAGAAGACGGCATA-3 ‘) и oNTI201 (5′-AATGATACGGCGACCACCGACAGGTTCAGTTCTACAGT’CCGACG-3′).Продукт ПЦР запускали на 10% геле ТВЕ и элюировали, как на предыдущем этапе. Библиотеки секвенировали на Illumina hi-Seq2000 с праймером для секвенирования 5’-CGACAGGTTCAGAGTTCTACAGTCCGACGATC-3 ‘.

    Трансфекция

    Для нокдауна PPARγ siRNA зрелые дифференцированные адипоциты 3T3-L1 электропорировали с использованием линии клеток Amaxa L (программа A-033, Lonza). Четверть 10-см чашки клеток обрабатывали 200 пмоль миРНК (последовательности в дополнительной таблице S3) и высевали на одну лунку 12-луночной чашки.Клетки собирали через 24–30 ч после трансфекции.

    ChIP-seq

    ChIP выполняли, как описано ранее (Steger et al. 2008). В этом исследовании были использованы следующие антитела: C / EBPα (sc-61x, Santa Cruz Biotechnology), C / EBPβ (sc-150x, Santa Cruz Biotechnology), FOSL2 (sc-13017x, Santa Cruz Biotechnology), JUND (sc- 74x, Santa Cruz Biotechnology), ATF2 (sc-6233x, Santa Cruz Biotechnology), MED1 (A300-793A, Bethyl Laboratories), h4K27ac (ab4729, Abcam), CBP (sc-369x, Santa Cruz Biotechnology), p300 (sc- 585x, Santa Cruz Biotechnology) и NCoR (поликлональный кролик, созданный в нашей лаборатории).Последовательности праймеров, используемые для ChIP-qPCR, представлены в дополнительной таблице S2. ChIP ДНК была подготовлена ​​для секвенирования в соответствии с протоколом амплификации, предоставленным Illumina. Секвенирование следующего поколения библиотек ChIP-seq было выполнено Functional Genomics Core в Университете Пенсильвании, включая предварительную обработку и выравнивание необработанных тегов.

    Обработка данных GRO-seq

    Сначала последовательности адаптера и поли-A были вырезаны из необработанных тегов, а оставшиеся теги были преобразованы в формат FASTA перед выравниванием.Обрезанные теги были выровнены по геному мыши mm8 с использованием Bowtie (Langmead et al. 2009) со следующими параметрами: входные данные были в формате FASTA (-f), для каждого тега было разрешено три несовпадения (-v 3), и только однозначно отображалось теги были сохранены (-m 1). Все выравнивания доводили до 50 пар оснований (п.н.) путем удлинения к 3′-концу, если их размер был меньше, чтобы сделать библиотеки сопоставимыми. Для визуализации данных GRO-seq мы объединили две реплики для каждой временной точки и расширили каждый тег до 150 п.н., чтобы получить гладкие профили.Файлы bedGraph сначала были сгенерированы с помощью команды genomeCoverageBed в наборе BEDTools (Quinlan and Hall 2010) для положительных и отрицательных цепей отдельно и были преобразованы в формат bigwig с помощью команды bedGraphToBigWig в пакете BLAT (Kent et al. 2010). Все данные микроматрицы и высокопроизводительного секвенирования были депонированы в Gene Expression Omnibus под номером доступа {«type»: «entrez-geo», «attrs»: {«text»: «GSE56747», «term_id»: » 56747 «}} GSE56747.

    Обработка данных ChIP-seq

    Все теги ChIP-seq для C / EBPα, C / EBPβ, FOSL2, ATF2, JUND, NCoR и MED1 были согласованы с геномом мыши mm8 с использованием Bowtie с опциями ”-k 1 — m 1 – best –strata », и все избыточные теги были удалены, кроме одного, перед последующим анализом.Для PPARγ мы использовали два общедоступных данных PPARγ ChIP-seq, {«type»: «entrez-geo», «attrs»: {«text»: «GSM340799», «term_id»: «340799»}} GSM340799 и {» type «:» entrez-geo «,» attrs «: {» text «:» GSM678393 «,» term_id «:» 678393 «}} GSM678393 (Nielsen et al. 2008; Schmidt et al. 2011) из Gene Expression Omnibus, где все избыточные теги были удалены в каждом наборе данных, а оставшиеся теги были объединены в единый набор данных. Вызов пиков выполнялся с помощью команды findPeaks в Homer (Heinz et al. 2010). После первоначального вызова размер всех пиков был изменен до 200 п.н .; отсечка 2 чтения на миллион (об / мин) применялась для C / EBPα, C / EBPβ, FOSL2, ATF2, JUND и PPARγ для выбора сильных пиков; и отсечка 1 об / мин применялась для MED1, CBP, p300 и NCoR из-за их непрямого геномного связывания.

    Анализ транскрипции гена

    Чтобы определить rosi-индуцированную регуляцию транскрипции гена, мы использовали нормализованное количество меток в пределах окна от +0,5 т.п.н. до 12 т.п.н. TSS, чтобы зафиксировать острые изменения и при этом минимизировать смещение из-за приостановленного сигнала на промоторах. При подсчете тегов мы игнорировали теги, выровненные по рРНК, малой ядрышковой РНК (мяРНК), малой ядерной РНК (мяРНК) или тРНК, чтобы избежать любого ложного вклада в сигнал GRO-seq тела гена из-за этих очень распространенных элементов.Чтобы идентифицировать гены, регулируемые rosi, мы выполнили точный тест с пакетом edgeR (Робинсон и др., 2010) для каждой временной точки — 10 минут, 30 минут, 1 час и 3 часа — используя 0 минут в качестве контроля. Гены считались регулируемыми rosi, если частота ложных обнаружений (FDR) была <0,05 в любой момент времени, но гены с низким уровнем сигнала GRO-seq (<0,5 RPKM [считываний на килобазу на миллион]) или плохим покрытием тела генами (<70 %) в каждый момент времени отбрасывались перед последующим анализом. Временные паттерны регуляции, индуцированной rosi, были графически представлены иерархической кластеризацией, где уровни GRO-seq были нормализованы по RPKM, а 1 - (коэффициент корреляции) использовался в качестве меры расстояния между генами.Первоначальная дендрограмма сначала была создана на основе критерия Уорда с использованием пакета fastcluster R (http://danifold.net/fastcluster.html), а затем подвергнута оптимальному упорядочиванию листьев (Bar-Joseph et al. 2001). При визуализации кластерных тепловых карт значения RPKM были преобразованы в журнал 2 (кратное изменение за 0 мин) для интуитивно понятного цветового представления повышающего или понижающего регулирования. Анализ онтологии генов был выполнен с использованием DAVID (Хуанг и др., 2008), и были представлены термины GO FAT, занимающие первое место.

    Анализ эРНК

    Для анализа эРНК мы определили энхансер как межгенный центр двунаправленного транскрипта. После объединения обеих реплик для улучшения покрытия транскриптов для каждой временной точки мы идентифицировали все предполагаемые транскрипты в положительных и отрицательных цепях с помощью команды findPeaks в Homer. Два стартовых сайта плюс-транскрипта и минус-транскрипт были спарены вместе, если их расстояние было <1 т.п.н., а затем их средняя точка была определена как центр двунаправленного транскрипта.Любые из этих центров были отброшены, если они расположены в пределах 2 т.п.н. от генов RefSeq или сателлитных областей, чтобы избежать потенциального отклонения от транскриптов тела гена или обильного сигнала от сателлитных регионов. Для исследования регуляции рози-индуцированной эРНК мы использовали конвейер, аналогичный анализу транскриптов генов, со следующими отличиями. При подсчете тегов для eRNA мы рассматривали окно размером 2 kb только вокруг ранее определенного энхансера и суммировали плюсовые и минусовые теги. Ограничение покрытия не применялось, но 0.Отсечка 5 РПКМ по-прежнему применялась. Среди эРНК, прошедших границу, те, у которых FDR <0,05, считались rosi-регулируемыми, а другие считались нерегулируемыми. Для кластерного анализа мы использовали log 2 (кратное изменение по сравнению с необработанными) для каждой временной точки и евклидова расстояния. Первоначальная дендрограмма была создана по критерию Уорда, а затем подверглась оптимальному упорядочиванию листьев. Поиск мотивов de novo выполнялся с использованием Гомера более одного раза для данного набора геномных локусов, и согласованные мотивы рассматривались для последующего анализа только в том случае, если они появлялись последовательно со значительным P-значением.

    Благодарности

    Мы благодарим сотрудников лаборатории Lazar за полезные обсуждения и реагенты, а также Клауса Кестнера за критическое чтение рукописи. Мы также благодарим Leighton Core, John Lis, Minna Kaikkonen и Chris Glass за помощь с протоколом GRO-seq; Фанг Чен и Дон Болдуин за выполнение микроматриц; и «Ядро функциональной геномики» Центра диабета Пенсильвании (DK19525) для глубокого секвенирования. A.P. был поддержан грантом на мобильность GEN-AU от Министерства науки и исследований Австрии.Эта работа также была поддержана грантами Национального института здравоохранения R01 DK49780 (для M.A.L.), R21DK098769 (для K.-J.W.) и 5T32GM008076 (для S.E.S.) и фондом JPB.

    Ссылки

    • Ahmadian M, Suh JM, Hah N, Liddle C, Atkins AR, Downes M, Evans RM
      2013.
      Передача сигналов PPARγ и метаболизм: хорошее, плохое и будущее. Нат Мед
      19: 557–566 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Bar-Joseph Z, Gifford DK, Jaakkola TS
      2001 г.
      Быстрое оптимальное упорядочение листьев для иерархической кластеризации.Биоинформатика
      17: S22 – S29 [PubMed] [Google Scholar]
    • Bugge A, Grontved L, Aagaard MM, Borup R, Mandrup S
      2009 г.
      A / B-домен PPARγ2 играет специфичную для гена роль в трансактивации и рекрутировании кофакторов. Методы Энзимол
      23: 794–808 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Chao L, Marcus-Samuels B, Mason MM, Moitra J, Vinson C, Arioglu E, Gavrilova O, Reitman ML
      2000 г.
      Жировая ткань необходима для антидиабетического, но не для гиполипидемического действия тиазолидиндионов.J Clin Invest
      106: 1221–1228 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Chawla A, Lazar MA
      1994 г.
      Пути передачи сигналов пероксисом и ретиноидов совместно регулируют фенотип и выживаемость преадипоцитов. Proc Natl Acad Sci
      91: 1786–1790 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Choi JH, Banks AS, Estall JL, Kajimura S, Bostrom P, Laznik D, Ruas JL, Chalmers MJ, Kamenecka TM, Bluher M, et al. al.
      2010 г.
      Антидиабетические препараты ингибируют фосфорилирование PPARγ с помощью Cdk5, связанное с ожирением.Природа
      466: 451–456 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Core LJ, Waterfall JJ, Lis JT
      2008 г.
      Секвенирование зарождающейся РНК выявляет широко распространенные паузы и дивергентную инициацию на промоторах человека. Наука
      322: 1845–1848 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • De Santa F, Barozzi I, Mietton F, Ghisletti S, Polletti S, Tusi BK, Muller H, Ragoussis J, Wei CL, Natoli G
      2010 г.
      Большая часть сайтов транскрипции экстрагенной РНК pol II перекрывается энхансерами. PLoS Biol
      8: e1000384.[Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Fronsdal K, Engedal N, Slagsvold T, Saatcioglu F
      1998 г.
      Связывающий белок CREB является коактиватором рецептора андрогенов и опосредует перекрестную связь с AP-1. J Biol Chem
      273: 31853–31859 ​​[PubMed] [Google Scholar]
    • Ge K, Guermah M, Yuan CX, Ito M, Wallberg AE, Spiegelman BM, Roeder RG
      2002 г.
      Коактиватор транскрипции TRAP220 необходим для адипогенеза, стимулированного PPARγ2. Природа
      417: 563–567 [PubMed] [Google Scholar]
    • Gelman L, Zhou G, Fajas L, Raspe E, Fruchart JC, Auwerx J
      1999 г.p300 взаимодействует с N- и C-концевой частью PPARγ2 лиганд-независимым и -зависимым образом, соответственно. J Biol Chem
      274: 7681–7688 [PubMed] [Google Scholar]
    • Gill G, Ptashne M
      1988 г.
      Отрицательный эффект активатора транскрипции GAL4. Природа
      334: 721–724 [PubMed] [Google Scholar]
    • Glass CK, Rosenfeld MG
      2000 г.
      Обмен корегулятора в транскрипционных функциях ядерных рецепторов. Genes Dev
      14: 121–141 [PubMed] [Google Scholar]
    • Glass CK, Saijo K
      2010 г.Пути трансрепрессии ядерных рецепторов, регулирующие воспаление в макрофагах и Т-клетках. Нат Рев Иммунол
      10: 365–376 [PubMed] [Google Scholar]
    • Хоконссон А.К., Шталь Мадсен М., Нильсен Р., Санделин А., Мандруп С.
      2013.
      Острые общегеномные эффекты розиглитазона на транскрипционные сети PPARγ в адипоцитах. Методы Энзимол
      27: 1536–1549 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • He W, Barak Y, Hevener A, Olson P, Liao D, Le J, Nelson M, Ong E, Olefsky JM, Evans RM
      2003 г.Нокаут рецептора γ, активируемого пролифератором пероксисом, специфичным для жировой ткани, вызывает инсулинорезистентность в жире и печени, но не в мышцах. Proc Natl Acad Sci
      100: 15712–15717 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • He HH, Meyer CA, Chen MW, Jordan VC, Brown M, Liu XS
      2012 г.
      Дифференциальная гиперчувствительность к ДНКазе I выявляет фактор-зависимую динамику хроматина. Genome Res
      22: 1015–1025 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C, Singh H, Glass CK
      2010 г.Простые комбинации факторов транскрипции, определяющих клонирование, активируют цис-регуляторные элементы, необходимые для идентичности макрофагов и В-клеток. Mol Cell
      38: 576–589 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Hofmann C, Lorenz K, Braithwaite SS, Colca JR, Palazuk BJ, Hotamisligil GS, Spiegelman BM
      1994 г.
      Измененная экспрессия гена фактора некроза опухоли-α и его рецепторов во время лекарственной и диетической модуляции инсулинорезистентности. Эндокринология
      134: 264–270 [PubMed] [Google Scholar]
    • Хуанг В., Гласс С.К.
      2010 г.Ядерные рецепторы и контроль воспаления: молекулярные механизмы и патофизиологическое значение. Артериосклер Thromb Vasc Biol
      30: 1542–1549 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Huang DW, Sherman BT, Lempicki RA
      2008 г.
      Систематический и комплексный анализ больших списков генов с использованием ресурсов биоинформатики DAVID. Нат Проток
      4: 44–57 [PubMed] [Google Scholar]
    • Kaikkonen MU, Spann NJ, Heinz S, Romanoski CE, Allison KA, Stender JD, Chun HB, Tough DF, Prinjha RK, Benner C и др.2013.
      Ремоделирование энхансерного ландшафта во время активации макрофагов связано с транскрипцией энхансера. Mol Cell
      51: 310–325 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin SC, Heyman RA, Rose DW, Glass CK и др. al.
      1996 г.
      Комплекс интегратора CBP опосредует активацию транскрипции и ингибирование AP-1 ядерными рецепторами. Клетка
      85: 403–414 [PubMed] [Google Scholar]
    • Kelleher RJ, Flanagan PM, Kornberg RD
      1990 г.Новый медиатор между белками-активаторами и аппаратом транскрипции РНК-полимеразы II. Клетка
      61: 1209–1215 [PubMed] [Google Scholar]
    • Кент В.Дж., Цвейг А.С., Барбер Г., Хинрихс А.С., Карольчик Д.
      2010 г.
      BigWig и BigBed: возможность просмотра больших распределенных наборов данных. Биоинформатика
      26: 2204–2207 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Kim SW, Kim HJ, Jung DJ, Lee SK, Kim YS, Kim JH, Kim TS, Lee JW
      2001 г.
      Ретиноид-зависимый антагонизм трансактивации сывороточного фактора ответа, опосредованный белками-коактиваторами транскрипции.Онкоген
      20: 6638–6642 [PubMed] [Google Scholar]
    • Ким Т.К., Хемберг М., Грей Дж. М., Коста А.М., Медведь Д.М., Ву Дж., Хармин Д.А., Лаптевич М., Барбара-Хейли К., Куэрстен С. и др.
      2010 г.
      Широко распространенная транскрипция энхансеров, регулирующих активность нейронов. Природа
      465: 182–187 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Kung J, Henry RR
      2012 г.
      Безопасность тиазолидиндиона. Экспертное мнение Drug Saf
      11: 565–579 [PubMed] [Google Scholar]
    • Лам М.Т., Чо Х., Леш Х.П., Госселин Д., Хайнц С., Танака-Оиши И., Беннер С., Кайкконен М.Ю., Ким А.С., Косака М. и др.2013.
      Rev-Erbs подавляет экспрессию генов макрофагов путем ингибирования транскрипции, направляемой энхансером. Природа
      498: 511–515 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Langmead B, Trapnell C, Pop M, Salzberg SL
      2009 г.
      Сверхбыстрое и эффективное выравнивание коротких последовательностей ДНК с геномом человека. Геном Биол
      10: R25. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Lee YK, Dell H, Dowhan DH, Hadzopoulou-Cladaras M, Moore DD
      2000 г.
      Сиротский ядерный рецептор SHP ингибирует ядерный фактор 4 гепатоцитов и трансактивацию рецептора ретиноида X: два механизма репрессии.Mol Cell Biol
      20: 187–195 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Лефтерова М.И., Чжан Й., Стегер Д.Д., Шупп М., Шуг Дж., Кристанчо А., Фэн Д., Чжуо Д., Штокерт С.Дж.-младший, Лю XS, и другие.
      2008 г.
      Факторы PPARγ и C / EBP регулируют биологию адипоцитов посредством соседнего связывания в масштабе всего генома. Genes Dev
      22: 2941–2952 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA
      1995 г.
      Антидиабетический тиазолидиндион является лигандом с высоким сродством к рецептору γ, активируемому пролифератором пероксисом (PPARγ).J Biol Chem
      270: 12953–12956 [PubMed] [Google Scholar]
    • Li Y, Lazar MA
      2002 г.
      Дифференциальная регуляция гена агонистом PPARγ и конститутивно активным PPARγ2. Методы Энзимол
      16: 1040–1048 [PubMed] [Google Scholar]
    • Li M, Pascual G, Glass CK
      2000 г.
      Активированный пролифератором пероксисом рецептор γ-зависимая репрессия индуцибельного гена синтазы оксида азота. Mol Cell Biol
      20: 4699–4707 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Li W, Notani D, Ma Q, Tanasa B, Nunez E, Chen AY, Merkurjev D, Zhang J, Ohgi K, Song X и др. al.2013.
      Функциональная роль энхансерных РНК в эстроген-зависимой активации транскрипции. Природа
      498: 516–520 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Маэда Н., Такахаши М., Фунахаши Т., Кихара С., Нисидзава Х., Кишида К., Нагаретани Х., Мацуда М., Комуро Р., Оучи Н. и др. al.
      2001 г.
      Лиганды PPARγ увеличивают экспрессию и концентрацию в плазме адипонектина, белка, полученного из жировой ткани. Сахарный диабет
      50: 2094–2099 [PubMed] [Google Scholar]
    • Manna PR, Stocco DM
      2007 г.
      Перекрестные помехи CREB и Fos / Jun на одном цис-элементе: репрессия транскрипции стероидогенного гена острого регуляторного белка.Дж Мол Эндокринол
      39: 261–277 [PubMed] [Google Scholar]
    • Melo CA, Drost J, Wijchers PJ, van de Werken H, de Wit E, Oude Vrielink JA, Elkon R, Melo SA, Leveille N, Kalluri R и др. .
      2013.
      еРНК необходимы для р53-зависимой энхансерной активности и транскрипции генов. Mol Cell
      49: 524–535 [PubMed] [Google Scholar]
    • Мойерс Дж. С., Шиянова Т. Л., Мербод Ф., Данбар Дж. Д., Ноблитт Т. В., Отто К. А., Райфель-Миллер А., Харитоненков А.
      2007 г.
      Молекулярные детерминанты активности FGF-21 — синергизм и перекрестная связь с передачей сигналов PPARγ.J Cell Physiol
      210: 1–6 [PubMed] [Google Scholar]
    • Nielsen R, Pedersen TA, Hagenbeek D, Moulos P, Siersbaek R, Megens E, Denissov S, Borgesen M, Francoijs KJ, Mandrup S, et al.
      2008 г.
      Полногеномное профилирование занятости PPARγ: RXR и РНК-полимеразы II выявляет временную активацию различных метаболических путей и изменения в составе димеров RXR во время адипогенеза. Genes Dev
      22: 2953–2967 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Нолан Дж. Дж., Людвик Б., Бирдсен П., Джойс М., Олефски Дж.
      1994 г.Улучшение толерантности к глюкозе и инсулинорезистентности у пациентов с ожирением, получавших троглитазон. N Engl J Med
      331: 1188–1193 [PubMed] [Google Scholar]
    • Оно Х., Шинода К., Шпигельман Б.М., Каджимура С.
      2012 г.
      Агонисты PPARγ вызывают преобразование белого жира в коричневый за счет стабилизации белка PRDM16. Cell Metab
      15: 395–404 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Pascual G, Fong AL, Ogawa S, Gamliel A, Li AC, Perissi V, Rose DW, Willson TM, Rosenfeld MG, Glass CK
      2005 г.Зависимый от SUMOylation путь опосредует трансрепрессию генов воспалительного ответа с помощью PPAR-γ. Природа
      437: 759–763 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Паскуаль-Гарсия М., Рю Л., Леон Т., Джульве Дж., Карбо Дж. М., Маталонга Дж., Ауэр Х., Селада А., Эскола-Гиль Дж. К., Steffensen KR, et al.
      2013.
      Взаимный негативный перекрестный обмен между Х-рецепторами печени (LXR) и STAT1: влияние на IFN-γ-индуцированные воспалительные реакции и LXR-зависимую экспрессию генов. J Immunol
      190: 6520–6532 [PubMed] [Google Scholar]
    • Quinlan AR, Hall IM
      2010 г.BEDTools: гибкий набор утилит для сравнения геномных характеристик. Биоинформатика
      26: 841–842 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Rangwala SM, Lazar MA
      2004 г.
      Рецептор γ, активируемый пролифератором пероксисом, при диабете и метаболизме. Тенденции Pharmacol Sci
      25: 331–336 [PubMed] [Google Scholar]
    • Rival Y, Stennevin A, Puech L, Rouquette A, Cathala C, Lestienne F, Dupont-Passelaigue E, Patoiseau JF, Wurch T, Junquero D
      2004 г.
      Репортерный анализ, управляемый промотором гена адипоцитного связывающего жирную кислоту белка (aP2) человека, позволяет различать нелипогенные лиганды рецептора, активируемого пролифератором пероксисом.J Pharmacol Exp Ther
      311: 467–475 [PubMed] [Google Scholar]
    • Робинсон, доктор медицины, Маккарти, ди-джей, Смит Г.К.
      2010 г.
      edgeR: пакет Bioconductor для анализа дифференциальной экспрессии цифровых данных экспрессии генов. Биоинформатика
      26: 139–140 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Rong JX, Klein JL, Qiu Y, Xie M, Johnson JH, Waters KM, Zhang V, Kashatus JA, Remlinger KS, Bing N, et al. al.
      2011 г.
      Розиглитазон индуцирует митохондриальный биогенез в дифференцированных адипоцитах мышей 3T3-L1 и C3H / 10T1 / 2.PPAR Res
      2011: 179454. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM
      1999 г.
      PPARγ необходим для дифференциации жировой ткани in vivo и in vitro. Mol Cell
      4: 611–617 [PubMed] [Google Scholar]
    • Schimke RT, Doyle D
      1970 г.
      Контроль уровня ферментов в тканях животных. Анну Рев Биохим
      39: 929–976 [PubMed] [Google Scholar]
    • Шмидт С.Ф., Йоргенсен М., Чен Й., Нильсен Р., Санделин А., Мандруп С.
      2011 г.Межвидовое сравнение профилей C / EBPα и PPARγ в адипоцитах мыши и человека показывает взаимозависимое сохранение сайтов связывания. BMC Genomics
      12: 152. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Sears DD, Hsiao A, Ofrecio JM, Chapman J, He W, Olefsky JM
      2007 г.
      Селективная модуляция рекрутирования промотора и транскрипционной активности PPARγ. Biochem Biophys Res Commun
      364: 515–521 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Spiegelman BM, Green H
      1980 г.
      Контроль специфического биосинтеза белка при превращении жировой ткани в клетках 3Т3.J Biol Chem
      255: 8811–8818 [PubMed] [Google Scholar]
    • Steger DJ, Lefterova MI, Ying L, Stonestrom AJ, Schupp M, Zhuo D, Vakoc AL, Kim JE, Chen J, Lazar MA, et al.
      2008 г.
      Рекрутирование DOT1L / KMT4 и метилирование h4K79 повсеместно связаны с транскрипцией генов в клетках млекопитающих. Mol Cell Biol
      28: 2825–2839 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Степпан С.М., Бейли С.Т., Бхат С., Браун Э.Дж., Банерджи Р.Р., Райт С.М., Пател Х.Р., Ахима Р.С., Лазар М.А.
      2001 г.
      Гормон резистин связывает ожирение с диабетом.Природа
      409: 307–312 [PubMed] [Google Scholar]
    • Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM
      1994a.
      mPPARγ2: тканеспецифический регулятор энхансера адипоцитов. Genes Dev
      8: 1224–1234 [PubMed] [Google Scholar]
    • Tontonoz P, Hu E, Spiegelman BM
      1994b.
      Стимуляция адипогенеза в фибробластах с помощью PPARγ2, фактора транскрипции, активируемого липидами. Клетка
      79: 1147–1156 [PubMed] [Google Scholar]
    • Vernochet C, Peres SB, Davis KE, McDonald ME, Qiang L, Wang H, Scherer PE, Farmer SR
      2009 г.C / EBPα и корепрессоры CtBP1 и CtBP2 регулируют репрессию выбранных генов висцерального белого жира во время индукции коричневого фенотипа в белых адипоцитах агонистами рецептора γ, активируемыми пролифератором пероксисом. Mol Cell Biol
      29: 4714–4728 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Wang D, Garcia-Bassets I, Benner C, Li W, Su X, Zhou Y, Qiu J, Liu W., Kaikkonen MU, Ohgi KA , и другие.
      2011 г.
      Перепрограммирование транскрипции с помощью различных классов энхансеров, функционально определяемых эРНК.Природа
      474: 390–394 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Westin S, Kurokawa R, Nolte RT, Wisely GB, McInerney EM, Rose DW, Milburn MV, Rosenfeld MG, Glass CK
      1998 г.
      Взаимодействия, контролирующие сборку гетеродимеров и коактиваторов ядерных рецепторов. Природа
      395: 199–202 [PubMed] [Google Scholar]
    • Wrann CD, Eguchi J, Bozec A, Xu Z, Mikkelsen T., Gimble J, Nave H, Wagner EF, Ong SE, Rosen ED
      2012 г.
      FOSL2 способствует экспрессии гена лептина в адипоцитах человека и мыши.J Clin Invest
      122: 1010–1021 [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Yang Q, Graham TE, Mody N, Preitner F, Peroni OD, Zabolotny JM, Kotani K, Quadro L, Kahn BB
      2005 г.
      Связывающий ретинол белок 4 сыворотки способствует развитию инсулинорезистентности при ожирении и диабете 2 типа. Природа
      436: 356–362 [PubMed] [Google Scholar]
    • Zhang Z, Teng CT
      2001 г.
      Рецептор эстрогена α и связанный с рецептором эстрогена рецептор α1 конкурируют за связывание и коактиватор. Молекулярный эндокринол
      172: 223–233 [PubMed] [Google Scholar]

    Полногеномное моделирование кинетики транскрипции выявляет закономерности задержки продукции РНК

    Значение

    Транскрипция генов — это строго регулируемый динамический процесс.Задержки транскрипции имеют важные последствия для динамики экспрессии генов и, следовательно, для последующей биологической функции. Мы моделируем временную динамику транскрипции, используя данные о динамике транскрипции и концентрацию мРНК в масштабе всего генома. Мы обнаружили, что значительное количество генов демонстрирует длительную задержку обработки РНК между окончанием транскрипции и производством мРНК. Эти длительные задержки обработки более характерны для коротких генов, которые в противном случае, как ожидается, будут транскрибироваться наиболее быстро.Распределение интронных чтений предполагает, что эти задержки необходимы для завершения сплайсинга. Понимание таких задержек важно для понимания того, как регулируется быстрый клеточный ответ.

    Abstract

    Гены со сходной кинетикой активации транскрипции могут иметь очень разные временные профили мРНК из-за различий во времени транскрипции, скорости деградации и кинетике процессинга РНК. Недавние исследования показали, что задержка образования РНК, связанная со сплайсингом, может быть значительной.Чтобы исследовать эту проблему в более общем плане, полезно разработать методы, применимые к наборам данных по всему геному. Мы представляем совместную модель активации транскрипции и накопления мРНК, которую можно использовать для вывода о скорости транскрипции, задержке продукции РНК и скорости деградации с учетом данных из экспериментов по высокопроизводительному секвенированию во времени. Мы комбинируем модель механистического дифференциального уравнения с подходом непараметрического статистического моделирования, что позволяет нам охватить широкий диапазон кинетики активации, и мы используем оценку байесовского параметра для количественной оценки неопределенности в оценках кинетических параметров.Мы применяем модель к данным об активации рецептора эстрогена α в линии клеток рака молочной железы MCF-7. Мы используем данные о динамике ChIP-Seq РНК-полимеразы II, чтобы охарактеризовать активацию транскрипции, и данные о динамике мРНК-Seq для количественной оценки зрелых транскриптов. Мы обнаружили, что 11% генов с хорошим сигналом в данных показывают задержку более 20 минут между завершением транскрипции и продуцированием зрелой мРНК. Гены, демонстрирующие эти длительные задержки, значительно чаще оказываются короткими. Мы также обнаружили статистическую связь между высокой задержкой и поздним удержанием интронов в данных пре-мРНК, что указывает на значительные задержки продукции, связанные со сплайсингом, во многих генах.

    Индукция транскрипции посредством внеклеточной передачи сигналов может привести к быстрым изменениям в экспрессии многих генов. Установление времени событий во время этого процесса важно для понимания механизмов ограничения скорости, регулирующих реакцию, и жизненно важно для вывода о причинно-следственной связи регулирующих событий. Несколько процессов влияют на паттерны изобилия мРНК, наблюдаемые в клетке, включая кинетику инициации транскрипции, удлинения, сплайсинга и деградации мРНК.Недавно было продемонстрировано, что значительные задержки, связанные с кинетикой сплайсинга, могут быть важным фактором в целенаправленном исследовании генов, индуцированных фактором некроза опухоли (TNF-α) (1). Отсроченная транскрипция может играть важную функциональную роль в клетке, например, индуцировать колебания в петлях отрицательной обратной связи (2) или способствовать своевременным программам транскрипции с оптимальной эффективностью (3). Поэтому важно выявлять такие задержки и лучше понимать, как они регулируются.В этом исследовании мы объединяем данные ChIP-Seq РНК-полимеразы (pol-II) с данными RNA-Seq для изучения кинетики транскрипции передачи сигналов рецептора эстрогена (ER) в клетках рака молочной железы. Используя беспристрастный подход к общегеномному моделированию, мы находим доказательства больших задержек в производстве мРНК в 11% генов с поддающимся количественной оценке сигналом в наших данных. Статистический анализ генов, демонстрирующих большие задержки, показывает, что кинетика сплайсинга является важным фактором и может быть этапом, ограничивающим скорость индукции гена.

    Подход к высокопроизводительному секвенированию привлекателен, поскольку он дает широкий охват и, таким образом, позволяет нам раскрыть типичные свойства системы. Однако данные с высокой пропускной способностью связаны со значительными источниками шума, и временное разрешение наших данных обязательно снижается по сравнению с предыдущими исследованиями, в которых использовались более сфокусированные анализы на основе ПЦР (1, 4). Поэтому мы разработали статистически эффективный модельный подход для оценки интересующих кинетических параметров.Мы используем байесовскую оценку для принципиальной оценки неопределенности предполагаемых параметров модели. Наша модель может быть применена ко всем генам с достаточно сильным сигналом как в данных мРНК, так и в данных pol-II, с лишь небольшими ограничениями на форму профиля транскрипционной активации (здесь 1814 генов).

    В ряде других работ, изучающих динамику транскрипции и сплайсинга (например, ссылки 1, 5 и 6), отсутствует подробное динамическое моделирование, что ограничивает способность авторов правильно учитывать различные периоды полураспада мРНК.Наша статистическая модель включает линейное обыкновенное дифференциальное уравнение динамики транскрипции, включая деградацию мРНК. Подобные модели линейных дифференциальных уравнений были предложены в качестве моделей динамики мРНК ранее (4, 7, 8), но предполагали специфическую параметрическую форму для транскрипционной активности. Напротив, мы применяем непараметрический гауссовский процесс (GP), который может приспособиться к довольно общей форме транскрипционной активности. Как было продемонстрировано ранее (9–11), линейность дифференциального уравнения позволяет эффективно делать точный байесовский вывод о функции транскрипционной активности.Прежде чем представить наши результаты, мы обрисовываем наш подход к моделированию.

    Вывод задержек транскрипции на основе модели

    Наш подход к моделированию представлен на рис. 1. Мы моделируем динамику транскрипции с помощью линейного дифференциального уравнения, dm (t) dt = βp (t − Δ) −αm (t) , [1] где m (t) — количество зрелой мРНК, а p (t) — скорость транскрипции на 3′-конце гена в момент времени t, которая масштабируется параметром β, потому что мы не знаем масштаб наши оценки p (t). Параметр Δ отражает задержку между завершением транскрипции и продукцией зрелой мРНК.Мы называем это задержкой продукции РНК, определяемой как время, необходимое полимеразе для отделения от пре-мРНК и полного процессинга в зрелый транскрипт. Параметр α представляет собой скорость деградации мРНК, которая определяет период полужизни мРНК (t1 / 2 = ln2 / α). Мы выводим все параметры модели (α, β, Δ, а также дисперсию шума и параметры функции ковариации GP, обсуждаемые в разделе «Материалы и методы»), используя процедуру Монте-Карло с цепью Маркова (MCMC). Апостериорное распределение параметров модели дает количественную оценку нашей неопределенности, и мы используем процентили апостериорного распределения, когда сообщаем о вероятных регионах вокруг среднего или медианного значения.

    Рис. 1.

    Мультфильм, иллюстрирующий базовую биологию и сбор данных в единую точку времени (слева) и моделирование временных рядов (справа). Данные взяты из pol-II ChIP-Seq, суммированы по последним 20% тела гена, и RNA-Seq расщеплены с помощью вычислений на пре-мРНК и различные уровни экспрессии транскриптов мРНК. Моделирование справа показывает влияние изменения периода полужизни мРНК (t1 / 2) или задержки продукции РНК (Δ) на ответ модели: оба вызывают задержку пика мРНК относительно пика pol-II, но профили имеют в остальном различные формы.

    Мы измеряем транскрипционную активность p (t), используя данные временного курса pol-II ChIP-Seq, собранные близко к 3′-концу гена (чтения, лежащие в последних 20% транскрибируемой области). Наше основное предположение состоит в том, что количество pol-II на 3′-конце гена пропорционально скорости продукции зрелой мРНК после возможной задержки Δ, связанной с отключением от полимеразы и процессингом. Обилие мРНК измеряется с помощью сопоставления считываний RNA-Seq с аннотированными транскриптами, принимая во внимание все аннотированные транскрипты и разрешая неоднозначности картирования с помощью вероятностного метода (12) (см. Подробности в разделе «Методы»).Поскольку мы ограничиваем наш анализ данными pol-II, собранными с 3′-конца транскрибируемой области, мы не ожидаем значительного вклада в Δ от задержек транскрипции при подборе модели. Такие задержки транскрипции недавно были изучены путем моделирования динамики элонгации транскриптов с использованием временных данных pol-II ChIP-Seq (13) и данных по возникающей мРНК (GRO-Seq) (14) в одной и той же системе. Вместо этого мы сосредоточимся на задержках производства, которые могут возникнуть после завершения удлинения.

    Существующие подходы к подгонке моделей этого типа приняли параметрический вид для функции активации p (t) (4, 7, 8).Мы избегаем ограничения формы функции, используя непараметрическую байесовскую процедуру подбора p (t). Мы моделируем p (t) как функцию, взятую из GP, которая является распределением по функциям. Общие свойства функций, взятых из предшествующего GP, определяются «функцией ковариации», которую можно использовать для определения таких характеристик, как гладкость и стационарность. Мы выбираем ковариационную функцию, которая гарантирует, что p (t) является гладкой функцией времени, потому что наши данные усредняются по популяции ячеек. Наш выбор ковариационной функции нестационарен и обладает тем свойством, что функция имеет некоторую устойчивость и, следовательно, имеет тенденцию оставаться на одном уровне между наблюдениями (см. Приложение SI для получения дополнительной информации).Преимущество использования непараметрического подхода состоит в том, что нам нужно оценить только небольшое количество параметров, определяющих ковариационную функцию (в данном случае два, определяющих амплитуду и временной масштаб функции). Если бы мы представили p (t) как параметризованную функцию, нам пришлось бы оценить большее количество параметров, чтобы описать функцию с достаточной гибкостью. Процедура байесовского вывода, которую мы используем, чтобы связать каждый оцениваемый параметр с достоверной областью, была бы более сложной при включении этих дополнительных параметров.

    Ранее мы показали, как выполнять вывод по дифференциальным уравнениям, управляемым функциями, смоделированными с помощью GP (9⇓ – 11). Основное методологическое новшество в данной работе — включение запаздывания в уравнение. 1 и разработка схемы байесовского вывода для этого и других параметров модели. Вкратце, мы формулируем проблему как байесовский вывод с априорным распределением GP по p (t), которое может быть интегрировано для получения правдоподобия данных в соответствии с моделью в уравнении. 1 в предположении гауссовского шума наблюдения.Эта функция правдоподобия и ее градиент используются для вывода с помощью гамильтонова алгоритма MCMC (15) для получения апостериорного распределения по всем параметрам модели и полным функциям pol-II и мРНК p (t) и m (t).

    Результаты

    Мы моделируем транскрипционный ответ клеток рака молочной железы MCF-7 после стимуляции эстрадиолом (E2) для активации передачи сигналов ER-α. На рис. 2 показаны предполагаемые профили pol-II и мРНК для всех генов с достаточным сигналом для моделирования, а также некоторые конкретные примеры подобранных моделей и оцененных параметров задержки.Прежде чем обсуждать эти результаты ниже, мы описываем применение нашего метода к реалистичным смоделированным данным, чтобы оценить надежность нашего подхода к оценке параметров в ряде условий.

    Рис. 2.

    (слева) Тепловая карта предполагаемых профилей активности pol-II и мРНК после стимуляции клеток MCF-7 с помощью E2. Гены с достаточным сигналом для моделирования сортируются по времени пика активности pol-II в подобранной модели. (Справа) Примеры подобранной модели для шести генов (гены от A до F).Для каждого гена мы показываем соответствие, используя данные pol-II ChIP-Seq (собранные из последних 20% транскрибируемой области), представляющие транскрипционную активность p (t) (уравнение 1), и используя данные RNA-Seq для представляют экспрессию гена m (t). Сплошные красные и зеленые линии показывают средние оценки модели для профилей pol-II и мРНК, соответственно, с соответствующими вероятными регионами. В каждом случае мы показываем апостериорное распределение для предполагаемого параметра задержки Δ справа от временных профилей. Обратите внимание, что время окончательного измерения очень далеко друг от друга (ось x сжата для облегчения визуализации), что приводит к высокой неопределенности в подгонке модели на поздних временах.Однако это не оказывает значительного влияния на вывод о задержках для ранних индуцированных генов.

    Имитационные данные.

    Мы применили наш метод к данным, смоделированным из модели в формуле. 1 с использованием профиля p (t), выведенного с использованием данных pol-II из гена TIPARP (ген C на рис. 2; см. Приложение SI для получения дополнительных сведений о смоделированных данных). Мы смоделировали данные, используя разные значения α и Δ, чтобы проверить, можем ли мы точно вывести параметр задержки Δ. На рис. 3 показаны вероятные области Δ для разных основных уровней истинности (горизонтальные линии) и для разных скоростей деградации мРНК (период полураспада указан на оси абсцисс).Результаты показывают, что можно уверенно вывести Δ, при этом основная истина всегда находится в центральной части достоверной области. Максимальная ошибка в апостериорных средних оценках составляет менее 10 минут, а если они положительны, истинное значение всегда выше 25-го процентиля апостериорного. Мы заметили, что по мере увеличения периода полужизни мРНК наша уверенность в оценках задержки снижается. Это связано с тем, что мРНК интегрирует транскрипционную активность с течением времени, пропорциональную периоду полураспада, что приводит к более сложной проблеме вывода.Отметим также, что определение параметра деградации α обычно труднее, чем определение параметра задержки Δ (Приложение SI, рис. S1). Однако большая неопределенность в предполагаемой скорости деградации, по-видимому, не оказывает отрицательного влияния на вывод параметров задержки, которым здесь уделяется основное внимание. Для точного определения скорости деградации потребуется больше временных точек или другой интервал между ними. Дополнительные результаты оценки задержки в сценарии, в котором моделируемый период полураспада изменяется с течением времени, представлены в Приложении SI, Рис.S2. Эти результаты показывают, что полученные оценки задержки надежны даже в этом сценарии.

    Рис. 3.

    Коробчатые диаграммы апостериорных распределений параметров, иллюстрирующие выполнение оценки параметров на синтетических данных для параметра задержки Δ. Полужирные черные линии указывают на основную истину, используемую при генерации данных. Поле простирается от 25-го до 75-го процентиля апостериорного распределения, тогда как усы простираются от девятого до 91-го процентиля. Результаты показывают, что оценки задержки являются точными и надежными, причем истинное значение всегда находится в области высокой апостериорной плотности.

    ER Сигнализация.

    Мы применили наш метод к измерениям RNA-Seq и pol-II ChIP-Seq на клетках MCF-7, стимулированных E2 для активации передачи сигналов ER-α (методы). Измерения были взяты из клеток, извлеченных из одной и той же популяции, чтобы обеспечить прямое сопоставление временных точек между технологиями. Примеры соответствия нашей модели показаны на рис. 2. Примеры на рис. 2 показывают ряд различных типов поведения от раннего (от A до C) до позднего (от D до F) и от очень короткой задержки. (A, D и E) до более длительных задержек (B, C и F).Пример E на рис. 2, ECE1, показателен, потому что визуальный осмотр профилей предполагает возможную задержку, но более вероятное объяснение в соответствии с нашей моделью — более длительный период полужизни мРНК, а апостериорная вероятность большой задержки довольно низка. . В самом деле, хорошо известно, что различия в стабильности могут приводить к задержке экспрессии мРНК (16), и поэтому задержки пика экспрессии мРНК относительно времени пика pol-II недостаточны, чтобы указывать на задержку продукции. Изменения в сплайсинге могут быть еще одним потенциальным препятствием, но наш анализ данных RNA-Seq на основе транскриптов может это объяснить.Пример того, как более простой анализ RNA-Seq может потерпеть неудачу, представлен в Приложении SI, рис. S3.

    Оценки параметров моделей выявляют значительный набор генов с убедительными доказательствами длительных задержек между концом транскрипции и продукцией зрелой мРНК. Нам удалось получить хорошие модели для 1864 генов. Мы исключили 50 генов с задней средней задержкой> 120 мин, учитывая, что эти гены ненадежны из-за редкой выборки на поздних сроках, что очевидно из широких распределений апостериорной задержки.Из оставшихся 1814 генов с надежными оценками 204 (11%) имели заднюю медианную задержку более 20 минут между активностью pol-II и продукцией мРНК, тогда как 98 генов имели 25-й перцентиль задней задержки более 20 минут, что указывает на достоверность высокие оценки задержки. Гистограмма средних задержек показана на рис. 4 (слева). 120-минутное отсечение для больших задержек было выбрано путем визуального наблюдения за подбором моделей, которые, как правило, были разумными для более коротких задержек. Обратите внимание, что поздние временные точки в нашем наборе данных сильно разделены из-за используемого экспоненциального временного интервала, и, таким образом, модель демонстрирует высокий уровень неопределенности между этими точками (рис.2). Следовательно, гены, показывающие достоверные оценки задержки, обычно индуцируются на раннем этапе, так что моменты времени достаточно близки для уверенного заключения о времени задержки. Наша байесовская модель позволяет легко установить достоверность наших оценок параметров.

    Рис. 4.

    (слева) Гистограмма задних медиан задержки от 1864 генов, которые, как было установлено, хорошо соответствуют модели. Расчетные задержки более 120 минут считаются ненадежными и группируются вместе. Эти 50 генов были исключены из дальнейшего анализа, оставив 1814 генов для основного анализа.(Справа) Расчетная задержка транскрипции гена для самого длинного транскрипта в зависимости от расчетной задней медианной задержки продукции РНК. Задержка транскрипции оценивается исходя из предположения, что каждый ген следует средней скорости транскрипции, измеренной в исх. 14. Сплошная линия соответствует равным задержкам.

    Геномные особенности, связанные с долгоживущими генами.

    На основании предыдущих исследований (5, 6, 17) мы исследовали статистическую связь между наблюдаемой задержкой продукции РНК и геномными особенностями, связанными со сплайсингом.Мы обнаружили, что гены с короткой пре-мРНК (рис. 5, слева) чаще имеют длительные задержки. Мы также обнаружили, что гены, в которых отношение длины последнего интрона в самом длинном аннотированном транскрипте к общей длине транскрипта велико (рис. 5, справа), также с большей вероятностью будут иметь длительные задержки, но этот эффект, по-видимому, слабее. . Эти две геномные особенности, короткие пре-мРНК и относительно длинные конечные интроны, положительно коррелируют, что затрудняет разделение их эффектов.Для этого в приложении SI, рис. S6 показаны версии правой панели рис. 5, но только включающие гены с пре-мРНК длиной более 10 или 30 т.п.н. Количество генов с длинными конечными интронами в этих наборах меньше, и результирующие значения P, таким образом, менее экстремальны, но общая форма кривых такая же. Мы не обнаружили значимой связи с абсолютной длиной последнего интрона. Это может быть связано с тем, что в таких случаях два наблюдаемых эффекта будут иметь тенденцию к нейтрализации. Мы также проверили, связан ли пропуск экзона с длительными задержками, как сообщалось ранее (6).Соответствующие результаты (Приложение SI, рис. S7) не показывают существенной разницы в оценках задержек в генах с аннотированным пропуском экзона и без него.

    Рис. 5.

    Хвостовые вероятности задержек. (Слева) Гены, у которых самый длинный транскрипт пре-мРНК является коротким (m — длина от начала до конца транскрипции). (Справа) Гены с относительно длинными конечными интронами (f — отношение длины последнего интрона самого длинного аннотированного транскрипта гена к длине пре-мРНК этого транскрипта).Доля генов с большими задержками Δ показана красными и синими линиями (левая вертикальная ось). На обоих подзаголовках черная кривая обозначает значения P точного критерия Фишера на равенство долей, изображенного красной и синей кривыми, проведенными отдельно в каждой точке (правая вертикальная ось), а пунктирная линия обозначает порог значимости P <0,05. Подобные графики для других значений m и f, а также для различных настроек фильтра генов приведены в Приложении SI, рис. S4 и S5.

    Анализ интронного чтения и распределения pol-II.

    Мы исследовали, существуют ли доказательства различий в характере завершения сплайсинга для генов с длительной задержкой. Чтобы количественно оценить этот эффект, мы разработали индекс накопления конца пре-мРНК: отношение интронных прочтений в последних 50% пре-мРНК к интронным прочтениям в первых 50% на поздних (80–320 мин) и ранних (80–320 мин.) 10–40 мин) раз. Рис. 6 показывает, что гены с длительной оценочной задержкой демонстрируют увеличение позднего удержания интронов в более поздние сроки. Существует статистически значимая разница в средних значениях индекса для генов с короткой и длинной задержкой (P <0.01; Значения P теста суммы рангов Уилкоксона для различных интервалов короткой / большой задержки показаны на рис. 6). Пример слева на фиг. 6, DLX3, представляет собой относительно короткий ген размером около 5 т.п.н., и, таким образом, различия во времени не могут быть объяснены временем, необходимым для завершения транскрипции. Соответствующий анализ считываний pol-II ChIP-Seq, а также считываний GRO-Seq приведен в приложении SI, рис. S8. Анализ показывает явное накопление, связанное с задержкой, до последних 5%, ближайших к 3'-концу, тогда как для pol-II на последних 50% накопление является универсальным.Эти результаты предполагают, что наши гены с короткой задержкой имеют тенденцию к эффективному сплайсингу, тогда как гены с большой задержкой с большей вероятностью обнаруживают отсроченное сплайсинг к 3'-концу. Есть также свидетельства некоторого накопления pol-II около 3'-конца, хотя эффект кажется относительно слабым. Отметим, что Grosso et al. (18) идентифицировали гены с повышенным уровнем pol-II на 3'-конце, которые оказались преимущественно короткими, что согласуется с нашим набором отложенных генов, и с занятостью нуклеосом, соответствующей паузе на 3'-конце.

    Рис. 6.

    (Слева) Мы показываем плотность считывания РНК-Seq, однозначно картирующуюся на интроны в гене DLX3, суммированные в ячейках по 200 п.н. Область гена определяется от первого аннотированного начала транскрипции до конца последнего чтения интрона. Отношение числа интронных считываний после и до средней точки области гена используется для количественной оценки 3′-удержания интронов. Индекс накопления конца пре-мРНК — это разница между средними значениями этого отношения, рассчитанными для поздних времен (80–320 мин) и ранних времен (10–40 мин).(Справа) Различия в среднем индексе накопления пре-мРНК (левая вертикальная ось) в генах длинной задержки (синий) и генах короткой задержки (красный) как функция отсечки, используемой для различения двух групп (горизонтальная ось). Положительные значения указывают на увеличение числа прочтений 3′-интрона с течением времени. Черная линия показывает P-значения критерия суммы рангов Вилкоксона между двумя группами на каждом пороге (правая вертикальная ось).

    Относительная важность задержек производства и удлинения.

    Чтобы лучше понять, каковы этапы ограничения скорости в динамике транскрипции, мы оценили относительную важность наблюдаемых задержек продукции РНК по сравнению с задержками транскрипции, относящимися к времени элонгации.Мы оценили время элонгации для каждого гена, используя предполагаемую скорость транскрипции, соответствующую средней оценке 2,1 кб / мин из ссылки. 14 в сочетании с длиной самого длинного аннотированного транскрипта пре-мРНК. Другие (например, ссылка 13) сообщили о более высоких скоростях; так что этот подход должен обеспечить разумные верхние границы фактического времени элонгации для большинства генов. Сравнение этих задержек с нашими апостериорными оценками медианной задержки показано на рис. 4 (справа). На рисунке показано большинство генов с короткими задержками образования и умеренным временем элонгации в верхнем левом углу рисунка, но 14.3% (260/1814) генов имеют более длительную задержку продукции РНК, чем время элонгации.

    Обсуждение

    Посредством основанного на модели связанного анализа временных данных pol-II и мРНК мы раскрыли процессы, формирующие изменения экспрессии мРНК в ответ на передачу сигналов ER. Мы обнаружили, что у большого количества генов наблюдается значительная задержка производства. Мы также обнаружили, что задержки связаны с короткой общей длиной гена, относительно большой длиной конечного интрона и увеличением удержания поздних интронов с течением времени.Наши результаты подтверждают важную роль связанных со сплайсингом задержек в формировании сроков экспрессии генов в этой системе. Наше исследование дополняет открытие аналогичных больших задержек, связанных со сплайсингом, в более сфокусированном исследовании TNF-индуцированной экспрессии (1), указывая на то, что задержки сплайсинга, вероятно, являются важными детерминантами динамики экспрессии по ряду сигнальных путей.

    Известно, что сплайсинг может сильно влиять на кинетику транскрипции. Khodor et al. (5) провели сравнительное исследование эффективности сплайсинга у мышей и мух и обнаружили положительную корреляцию между абсолютной длиной гена и эффективностью сплайсинга.Это открытие указывает на то, что эффективному котранскрипционному сплайсингу способствует увеличенная длина гена и согласуется с нашим наблюдением, что задержки чаще встречаются в более коротких генах. В этих генах, по-видимому, зрелая мРНК не может продуцироваться после транскрипции до завершения сплайсинга; именно сплайсинг, а не транскрипция, является этапом, ограничивающим скорость для этих генов. В том же исследовании также было замечено, что интроны, близкие к 3′-концу гена, сплайсируются менее эффективно, что согласуется с нашим наблюдением, что относительная длина последнего интрона может влиять на задержки сплайсинга.Еще одна теоретическая модель, поддерживающая связь между длинными конечными интронами и неэффективностью сплайсинга, была недавно предложена (19), но неясно, может ли эта модель полностью объяснить наблюдаемые взаимосвязи.

    Наша модель предполагает постоянную скорость деградации мРНК, что может быть нереалистичным. Учитывая сложность оценки даже единственной постоянной скорости деградации для смоделированных данных, где истинная скорость постоянна, кажется невозможным сделать вывод, изменяющийся во времени, с текущими данными. С другой стороны, расчетные задержки были получены достаточно надежно, даже когда мы моделировали данные с изменяющейся во времени скоростью деградации (приложение SI, рис.S2), и, следовательно, потенциально неверная модель деградации не должна существенно влиять на основные результаты.

    Важно различать задержки, обнаруженные здесь, с задержками транскрипции, необходимыми для завершения элонгации pol-II. Время элонгации может быть важным фактором в определении времени индукции гена, и динамика элонгации была смоделирована с использованием измерений временного хода как pol-II ChIP-Seq (13), так и возникающей РНК (GRO-Seq) (14) в рассматриваемой системе. здесь. Однако в этом исследовании мы ограничили наше внимание данными pol-II на 3′-конце гена (т.е.е., измерение изменения плотности полимеразы в области, где удлинение почти завершено). Следовательно, мы не увидим задержек транскрипции в наших данных, а задержки, связанные со сплайсингом, обсужденные выше, не связаны со временем элонгации. В самом деле, наблюдаемые здесь задержки, связанные со сплайсингом, с большей вероятностью влияют на более короткие гены, транскрипция которых завершается быстро. Эти связанные со сплайсингом задержки гораздо труднее предсказать по геномным особенностям, чем задержки транскрипции, которые в основном определяются длиной гена, хотя мы показали связь с конечной длиной интрона и длиной гена.В будущем было бы полезно моделировать данные из других систем, чтобы установить связи с переменными, зависящими от системы (например, альтернативное использование сайта соединения) и, таким образом, раскрыть контекстно-зависимые механизмы, регулирующие задержки, которые мы здесь наблюдали.

    Материалы и методы

    Сбор и отображение данных.

    Клетки рака молочной железы MCF-7 стимулировали E2 после помещения в среду без E2 на 3 дня, аналогично методу, описанному ранее (13). Мы измерили занятость pol-II и концентрацию мРНК из той же популяции клеток, собранных в 10 временных точках по логарифмической шкале: 0, 5, 10, 20, 40, 80, 160, 320, 640 и 1280 мин после стимуляции E2.В каждый момент времени занятость pol-II измерялась по всему геному с помощью ChIP-Seq, а концентрация мРНК — с помощью RNA-Seq. Необработанные считывания из данных ChIP-Seq были сопоставлены с эталонной последовательностью генома человека (NCBI_build37) с использованием Genomatix Mining Station (версия программного обеспечения 3.5.2; дополнительные сведения см. В Приложении SI). В среднем 84,0% считываний ChIP-Seq однозначно картировались в геноме. Считывания RNA-Seq были сопоставлены с использованием bowtie с транскриптомом, построенным из аннотации Ensembl версии 68, допускающей не более трех несовпадений и игнорированием считываний с более чем 100 выравниваниями.Транскриптом был сформирован путем объединения транскриптомов кДНК и некодирующей РНК с последовательностями пре-мРНК, содержащими полную геномную последовательность от начала первого аннотированного экзона до конца последнего аннотированного экзона. В среднем было отображено 84,7% считываний RNA-Seq.

    Обработка данных RNA-Seq. Концентрация мРНК

    оценивалась по данным считывания RNA-Seq с использованием BitSeq (12). BitSeq — это вероятностный метод для определения экспрессии транскрипта из данных RNA-Seq после сопоставления с аннотированным транскриптомом.Мы оценили уровни экспрессии для всех записей в транскриптоме, включая транскрипты пре-мРНК, и использовали сумму экспрессий транскриптов мРНК во фрагментах на килобазу экзона на миллион картированных фрагментов (FPKM) единиц для оценки уровня экспрессии мРНК гена. . Различные моменты времени временного ряда RNA-Seq были нормализованы с использованием метода, описанного в ссылке. 20.

    pol-II ChIP-Seq Обработка данных.

    Данные ChIP-Seq были обработаны во временные ряды, суммирующие занятость pol-II в каждый момент времени для каждого гена человека.Мы считали последние 20% тела гена ближайшими к 3′-концу. Тело гена определяли от начала первого экзона до конца последнего экзона в аннотации Ensembl версии 68. Данные подлежали удалению фона с использованием вручную выбранных пустых областей в наборе данных S1 и нормализации временных точек. Области генов были уточнены для небольшого подмножества генов с использованием активных транскриптов, перечисленных в Dataset S2. (Полная информация находится в Приложении SI.)

    Фильтрация активных генов.

    Мы удалили гены без явной зависящей от времени активности, подгоняя зависящие от времени модели GP к кривым активности и оставляя только гены с байесовским фактором не менее 3 в пользу зависящей от времени модели по сравнению с нулевой моделью без временной зависимости. . Мы также удалили гены, которые не наблюдались в двух или более временных точках. В результате этого процесса осталось 4420 генов, для которых мы подобрали модели.

    Моделирование и оценка параметров.

    Мы моделируем взаимосвязь между занятостью pol-II и концентрацией мРНК, используя дифференциальное уравнение в уравнении.1, который связывает временной ряд p (t) pol-II и соответствующий временной ряд m (t) мРНК для каждого гена. Мы моделируем p (t) непараметрическим способом, применяя предварительный GP над формами функций. Мы немного модифицируем модель в формуле. 1 путем добавления константы β0 для учета ограниченной глубины измерений Pol-II ChIP-Seq, что дает dm (t) / dt = β0 + βp (t − Δ) −αm (t). Это дифференциальное уравнение может быть решено относительно m (t) как функции p (t) в замкнутой форме. Функция концентрации pol-II p (t) представлена ​​в виде выборки из предшествующего GP, которая может быть интегрирована для вычисления вероятности данных.Модель можно рассматривать как расширение предыдущей модели, применяемой для идентификации мишеней транскрипционных факторов (11). В отличие от исх. 11, мы моделируем p (t) как GP, определяемый как интеграл функции, имеющей предшествующий GP, с ковариацией RBF, что означает, что p (t) имеет тенденцию оставаться постоянным между наблюдаемыми данными вместо того, чтобы возвращаться к среднему значению. Кроме того, мы вводим задержку между концентрацией pol-II и продукцией мРНК, а также моделируем начальную концентрацию мРНК в качестве независимого параметра.В частном случае, когда Δ = 0 и m0 = β0 / α, Приложение SI, уравнение. 3 сводится к предыдущей модели (уравнение 4 в ссылке 11). Чтобы подогнать модель к временным данным pol-II и мРНК, отобранным в дискретные моменты времени, мы предполагаем, что наблюдаем m (t) и p (t), искаженные гауссовым шумом с нулевым средним, независимо отобранным для каждой временной точки. Мы предполагаем, что дисперсия шума pol-II является константой σp2, выведенной как параметр модели. Дисперсия шума мРНК для каждой временной точки представляет собой сумму общей константы σm2 и фиксированной дисперсии, выведенной BitSeq путем объединения технической неопределенности количественного определения из оценки экспрессии BitSeq с оценкой биологической дисперсии из модели дифференциального выражения BitSeq (подробные сведения приведены в Приложение СИ).

    Учитывая параметры дифференциального уравнения, вывод GP дает полное апостериорное распределение по форме функций pol-II и мРНК p (t) и m (t). Мы выводим параметры дифференциального уравнения из данных, используя выборку MCMC, что позволяет нам назначать уровень неопределенности для наших оценок параметров. Чтобы вывести полный апостериорный вывод по параметрам дифференциального уравнения β0, β, α, Δ, m0 и E [p0] = μp, параметрам модели наблюдения σp2 и σm2, а также параметру величины Cp и параметру ширины l предшествующего GP, мы установить почти плоские априорные значения для параметров в пределах разумных диапазонов значений, за исключением задержки Δ, априор которой смещен в сторону 0 (точные диапазоны и полная информация представлены в Приложении SI).Мы объединяем эти априорные вероятности с вероятностью, полученной из модели GP после маргинализации p (t) и m (t), что может быть выполнено аналитически. Мы делаем апостериорный вывод по параметрам с помощью гамильтоновой выборки MCMC. Этот полный подход MCMC использует градиенты распределений для эффективного отбора проб и строго учитывает неопределенность по параметрам дифференциального уравнения. Таким образом, последняя апостериорная оценка учитывает как неопределенность параметров дифференциального уравнения, так и неопределенность основных функций для каждого дифференциального уравнения.Мы запустили четыре параллельные цепочки, начиная с разных случайных начальных состояний, для проверки сходимости с использованием потенциального коэффициента уменьшения масштаба ref. 21. Мы получили по 500 образцов из каждой из четырех цепочек после отбрасывания первой половины образцов как приработки и утончения в 10 раз. Апостериорные распределения по функциям p (t) и m (t) были получены путем отбора проб. 500 реализаций p (t) и m (t) для каждой выборки параметров из точного гауссовского условного апостериорного метода с учетом параметров в выборке.Результирующие апостериорные значения для p (t) и m (t) не являются гауссовыми и суммируются апостериорным средним и апостериорными квантилями. Полная информация о процедуре MCMC находится в Приложении SI.

    Фильтрация результатов.

    Гены, удовлетворяющие следующим условиям, были сохранены для полного анализа (полные подробности реализации каждого шага приведены в Приложении SI): (i) p (t) имеет максимальный пик в области плотной выборки между 1 мин и 160 мин; (ii) расчетная задняя средняя задержка составляет менее 120 мин; и (iii) p (t) не изменяется слишком сильно до t = 0 мин, чтобы соответствовать известному началу в установившемся режиме.

    Анализ аннотаций генов, связанных с задержками.

    Аннотации Ensembl версии 68 были использованы для получения признаков всех генов. Для каждого аннотированного транскрипта мы вычислили общую длину пре-мРНК m как расстояние от начала первого экзона до конца последнего экзона и длины всех интронов. Транскрипты, состоящие только из одного экзона (и, следовательно, без интронов), были исключены из дальнейшего анализа. Для каждого гена мы идентифицировали транскрипт с самой длинной пре-мРНК и использовали его в качестве репрезентативного транскрипта для этого гена.Конечная доля интрона f определялась как длина последнего интрона самого длинного транскрипта, деленная на m.

    Индекс накопления концов пре-мРНК.

    Для этого анализа мы учитывали только однозначное выравнивание считываний с пре-мРНК-транскриптами, а не с какими-либо транскриптами мРНК. Мы подсчитывали перекрытие считываний с ячейками по 200 п.н., начиная с начала первого экзона каждого гена, заканчивая последним непустым ячейкой. Мы вычисляем долю re, i всех чтений во второй половине бинов в каждой выборке i и определяем индекс как разность средних значений re, i в поздних временных точках (80–320 мин) и в более ранних временных точках ( 10–40 мин).

    Выражение признательности

    Работа финансировалась Европейской инициативой ERASysBio + Project Systems Approach to Gen Regular Biology Through Nuclear Receptors (SYNERGY) (Грант BB / I004769 / 2 Совета по исследованиям биотехнологии и биологических наук, предоставленной JP, MR и NDL), Академии наук. Финляндия Грант 135311 (для AH и HT) и Bundesministerium für Bildung und Forschung Grants ERASysBio + P # 134 (для GR) и 0315715B (для KG). М.Р., Н.Д.Л. и К.Г. были дополнительно поддержаны проектом Седьмой рамочной программы Европейского союза RADIANT (Быстрая разработка и распространение статистических инструментов для высокопроизводительных данных секвенирования) (грант 305626), а также A.H. и J.P. были дополнительно поддержаны грантами 252845, 259440 и 251170 Академии Финляндии.

    Сноски

    • Вклад авторов: A.H., J.P., H.G.S., G.R., N.D.L. и M.R., разработанные исследования; A.H., J.P., I.C. и F.M. проведенное исследование; J.P. разработал модель GP; A.H. разработал и провел вывод HMC; A.H., J.P. и M.R. интерпретировали результаты под руководством A.H. A.H., J.P., H.T., K.G. и M.R. проанализировали данные; и A.H., J.P. и M.R. написали статью.

    • Авторы заявляют об отсутствии конфликта интересов.

    • Эта статья представляет собой прямое представление PNAS.

    • Размещение данных: Данные, представленные в этой статье, были депонированы в базе данных Gene Expression Omnibus (GEO), www.ncbi.nlm.nih.gov/geo (инвентарный номер GSE62789).

    • Эта статья содержит вспомогательную информацию на сайте www.pnas.org/lookup/suppl/doi:10.1073/pnas.1420404112/-/DCSupplemental.

    Доступен бесплатно в режиме онлайн через опцию открытого доступа PNAS.

    Сравнительный анализ профилей транскриптов листьев хризантемы в ответ на солевой стресс

    Образец цитирования: Ву И-Х, Ван Т., Ван К., Лян Ц-И, Бай Ц-И, Лю Ц-Л и др. (2016) Сравнительный анализ профилей транскриптов листьев хризантемы в ответ на солевой стресс. PLoS ONE 11 (7):
    e0159721.

    https://doi.org/10.1371/journal.pone.0159721

    Редактор: Цзинь-Сун Чжан, Институт генетики и биологии развития Китайской академии наук, КИТАЙ

    Поступила: 11 февраля 2016 г .; Принята в печать: 7 июля 2016 г .; Опубликовано: 22 июля 2016 г.

    Авторские права: © 2016 Wu et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

    Финансирование: Авторы не получали специального финансирования на эту работу.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Засоление — один из наиболее значительных абиотических факторов, ограничивающих продуктивность и рост сельскохозяйственных культур [1]. Засоление может вызвать ряд морфологических, физиологических и биохимических изменений [2], таких как уменьшение количества цветочных бутонов, снижение водопоглощающей способности корня, усиление запрограммированной гибели клеток в некоторых типах тканей [1, 3]. В настоящее время необходимо повышение устойчивости растений к стрессу высокой солености. Стратегии генной инженерии нацелены на различные метаболические пути, накопление осмолитов, антиоксидантных ферментов и активацию функциональных генов [4].Среди сложных молекулярных механизмов активация экспрессии функциональных генов занимает важное место в устойчивости растений к соли [5, 6]. Различные гены, которые функционируют как сенсоры стресса в путях передачи сигналов, составляют сеть белок-белковых реакций и факторов транскрипции [7, 8]. Рецептороподобная киназа (RLK) [9], митоген-активированная протеинкиназа (MAPK) [10, 11], кальций-зависимая и кальмодулиннезависимая протеинкиназа (CDPK) [12] и белок, не ферментирующий сахарозу-1. киназа (SnRK) [13] участвует в сигнальных путях абиотического или биотического стресса.Более того, в соответствии с характеристиками ДНК-связывающего домена факторы транскрипции, связанные со стрессовой реакцией, можно разделить на несколько семейств, таких как bHLH, AP2 / EREBP, bZIP, NAC, WRKY, MYB и MYC [14, 15].

    Хризантема — известное в мире декоративное растение. Он имеет большие геномы и не имеет геномной информации на основе солеустойчивости [5]. В настоящее время разработка технологии секвенирования следующего поколения (NGS) стала основным подходом к аннотации функций генов, анализу экспрессии генов и идентифицировала многочисленные гены в фундаментальных молекулярных аспектах, связанных со стрессовой реакцией [16–18].В частности, этот метод не зависит от существующей геномной последовательности [19]. Очевидно, что NGS способствовала исследованию молекулярной биологии как на модельных, так и на немодельных заводах. Предыдущий анализ секвенирования транскриптома растений в условиях солевого стресса был сосредоточен на Arabidopsis thaliana [20–22], рисе [23, 24] и других модельных растениях. Хотя транскрипционные изменения в модельных растениях были идентифицированы, имеется очень ограниченная информация о молекулярных элементах, которые специфичны для немодельных растений в условиях солевого стресса.В последние годы анализ транскриптома немодельных видов, таких как Eleusine coracana [25], Chrysanthemum nankingense [26], Populus euphratica [27], сделал успехи в изучении молекулярных механизмов при солевом стрессе.

    Из-за частого орошения и высокой эвапотранспирации засоление в теплице серьезно повлияло на качество и количество срезанных хризантем [28]. Мы рассмотрели измерение транскриптомного состава хризантемы и идентифицировали регуляторные гены в соответствии с уровнями экспрессии генов в условиях солевого стресса.Кроме того, технология RNA-Seq также дала возможность понять сети регуляции генов. В конечном итоге мы получили DET между контрольными образцами и образцами, обработанными солью, и идентифицировали чувствительные к соли гены. Полученные данные будут полезны не только для идентификации потенциальных генов-кандидатов, подверженных солевому стрессу, но и для продвижения генной инженерии хризантем для улучшения солеустойчивости,

    Методы

    Растительные материалы и средства обработки

    Хризантема (Chrysanthemum morifolium (Ramat.) Tzvel.) ‘Jinba’, популярный сорт хризантемы, который использовался в этом эксперименте. Проростки выращивали на среде MS с термопериодом 25 ° C (день) и 22 ° C (ночь) и фотопериодом 16 часов. Через 24 дня проростки подвергали солевой обработке и использовали градиент концентрации раствора NaCl для замедления солевого повреждения: 100 мМ в первый день, 200 мМ во второй день и 400 мМ в течение трех дней. Контрольные сеянцы поливали ежедневно. Наконец, листья отбирали для последующей обработки РНК-Seq через 5 дней обработки (образцы листьев замораживали жидким азотом и хранили при -80 ° C).Для каждого лечения использовали три биологические повторы.

    Экстракция РНК, конструирование библиотеки RNA-seq и секвенирование

    Общая РНК была экстрагирована в соответствии с инструкциями производителя. Качество и количество общей РНК оценивали по коэффициенту поглощения (OD 260/280 и OD 260/230 ) и электрофорезу в 1% агарозном геле. Реплики были смешаны, чтобы получить 2 объединенных образца для анализа секвенирования. Библиотеки специфичных для цепей РНК-seq были сконструированы согласно Чжун и др.[29] и секвенировали на системе Illumina HiSeq2000, Shanghai Sangon Biotech, Шанхай, Китай. Необработанные данные секвенирования были отправлены в базу данных NCBI Sequence Read Archive (SRA) с регистрационным номером SRP074167.

    Анализ последовательности, сборка de novo и аннотации

    Необработанные считывания были очищены путем удаления последовательностей адаптеров, последовательностей низкого качества (считывания с неоднозначным основанием «N») и считывания с Q-значением <20 оснований [25]. Затем отбрасываем чтения длиной менее 35 п.н.Затем была произведена сборка de novo с использованием программного обеспечения Trinity (выпуск 20121005, http://trinityrnaseq.sourceforge.net/) для генерации унигенов [30]. Кроме того, были удалены избыточные повторяющиеся чтения.

    Полученные унигены подвергали анализу с использованием баз данных NCBI Nr (база данных неизбыточных белков NCBI), Swiss-Prot, TrEMBL, CDD (база данных консервативных доменов), Pfam и KOG (euKaryotic Orthologous Groups) (значение E ≤ 1e-5) [ 31]. Функциональная аннотация по GO (база данных Gene Ontology) была проанализирована с помощью программы Blast2GO [32].KEGG (Киотская энциклопедия генов и геномов) также использовалась для прогнозирования и классификации возможных функций.

    Идентификация дифференциально экспрессируемых генов

    Метод чтения RPKM (чистых чтений на килобазу на миллион) (http://www.clcbio.com/manual/genomics/Definition_RPKM.html) использовался для оценки количества транскриптов на основе устранения влияния разной длины генов и несоответствие секвенирования [33, 34]. Кроме того, мы использовали метод алгоритма, разработанного ранее, для сравнения различий в экспрессии генов [34, 35].Коэффициент ложного обнаружения (FDR) применялся для корректировки значения P при проверке множественных гипотез. И в этом анализе FDR ≤ 0,01 и абсолютное значение log 2 ratio ≥ 1 (двукратное изменение) были установлены в качестве порога для оценки значимости различий в экспрессии генов [36]. Идентифицированные DET затем подвергали функциональному анализу GO и анализу пути KEGG.

    Количественная проверка дифференциальной экспрессии с помощью ПЦР в реальном времени (qRT-PCR)

    Для проверки данных было отобрано восемь транскриптов, чувствительных к соли, для проведения qRT-PCR с тремя повторами.Конкретные праймеры были созданы с использованием Primer 5 (таблица 1). 20 мкл реакционной смеси для КПЦР содержали 10 мкл супермикса SsoFast EvaGreen (Bio-Rad, Геркулес, Калифорния, США), 2 мкл разбавленного образца кДНК, 300 нМ праймеров. А затем выполнили qRT-PCR с условиями цикла с использованием системы обнаружения Bio-Rad CFX96 TM : 95 ° C в течение 30 с, 40 циклов по 15 с при 95 ° C и 30 с при 60 ° C, в конце концов, получена кривая плавления. Наконец, мы использовали метод 2 -ΔΔCT для анализа данных и выбрали ген UBC (прямой праймер: CATCTACTCGTCAATCAGGGTT, обратный праймер: GTATGGGCTATCGGAAGGTC) в качестве ссылки [37].

    Результаты и обсуждение

    Секвенирование и сборка de novo

    NGS широко используется для секвенирования транскриптомов de novo, особенно у немодельных организмов [38]. В этом исследовании мы создали две библиотеки кДНК из хризантемы Jinba при нормальных условиях и условиях засоления, соответственно. И в общей сложности данные секвенирования 10,0 Гб были получены секвенированием по парным концам РНК Illumina Solexa. Учитывая, что эти чтения имеют значительно более высокий уровень ошибок, мы отфильтровали необработанные данные.Уровень удержания данных был высоким, и в итоге мы получили 94 миллиона чтений, средняя длина которых составляет 94,4 п.н. После этого сборка de novo сгенерировала 365 323 уникальных транскрипта (≥ 100 п.н.) со средней длиной 732,0 п.н. и 161 522 унигена (≥100 п.н.) со средней длиной 575,7 п.н. из этих считываний. Распределение длин для всех транскриптов и всех унигенов показано на рис. 1.

    Всего 88 049 транскриптов и 24 906 уникальных генов были больше 1000 п.н., а значения N50 и N90 показаны в таблице 2.Среди которых самый длинный транскрипт и униген были 12 403 п.н. Кроме того, частотное распределение собственных генов GC показано на рис. 2.

    Аннотация последовательностей транскриптов хризантем

    В отличие от различных баз данных белков на основе сходства аминокислотных последовательностей, мы аннотировали собранные транскрипты хризантемы. В общей сложности 65 838 (40,8%), 40 075 (24,8%), 67 450 (41,8%), 34 614 (21,4%), 58 863 (36,4%) и 23 477 (14,5%) унигенов сильно пострадали в NR, CDD, Швейцарии- Prot, Pfam, TrEMBL и KOG, соответственно (сходство> 30% и значение E ≤ 1e-5).Сходство генов в основном основывалось на BLASTx.

    Чтобы получить представление о процентном соотношении хризантем unigenes, которые показывают сходство с генами других видов растений, мы выполнили распределение видов хризантем в базе данных NR, в которой 76,5% генов были аннотированы наибольшим числом из 10 видов (рис. 3). Среди различных растений хризантема unigenes имела максимальное количество гомологов Vitis vinifera (42,0%), а Populus trichocarpa и Ricinus communis — 15.0% и 14,0% соответственно. Интересно, что это высокое сходство также было описано при изучении хризантемы nankingense (Asteraceae) [26]. А Glycine max (9,0%), Botryotinia fuckeliana (7,0%), другие (13,0%) оказались в следующем. Эти результаты могут продемонстрировать, что хризантема имеет более тесные связи с Vitis vinifera, в то время как Arabidopsis lyrata subsp. Лирата дальше.

    Мы дополнительно классифицировали функции, используя базу данных KOG. 23 477 унигенов были отнесены к 25 конкретным категориям KOG, которые перечислены на рис.4.В тройку лидеров вошли «механизмы передачи сигнала» с 5061 унигеном (21,6%), «посттрансляционная модификация, белковый оборот, шапероны» с 4938 унигенами (21,0%) и «предсказание общей функции» только с 3587 унигенами (15,3%). Категории KOG, связанные со стрессовой реакцией, следующие: «защитные механизмы» (0,8%), «биосинтез, транспорт и катаболизм вторичных метаболитов» (7,8%), «транспорт и метаболизм неорганических ионов» (3,5%) и «липид». , транспорт и метаболизм «кофермента», «углеводов», «нуклеотидов», «аминокислот» — 18.Всего 9%.

    Анализ GO позволил функциональную классификацию 12 153 унигена. Как показано на фиг. 5, среди которых 41,7% были отнесены к «категории биологических процессов», 31,3% — к «категории клеточных компонентов» и 27,0% — к «категории молекулярных функций». Основными классами биологических процессов среди сравнения классификации ГО были «метаболический процесс», «клеточный процесс», «реакция на раздражитель», «биологическая регуляция» и «регуляция биологического процесса». Преобладающими клеточными компонентами были «органелла», «клетка», «клеточная часть» и «мембрана».А для молекулярной функции были «связывание», «каталитическая активность», «активность переносчика электронов», «активность структурной молекулы» и «активность переносчика».

    Рис. 5. Функциональная классификация хризантем с помощью анализа онтологии генов (GO).

    В общей сложности 12 153 унигенам были присвоены GO-термины, и они классифицированы по трем категориям GO: биологический процесс, клеточный компонент и молекулярная функция.

    https://doi.org/10.1371/journal.pone.0159721.g005

    Кроме того, мы предсказали биохимические пути из базы данных KEGG, в которой в общей сложности 25 173 (15,6%) унигенена были сгруппированы в 306 путей. Анализ пути KEGG показал, что гены в основном расположены в «рибосоме» (ko03010, 2001 unigenes), «процессинге белка в эндоплазматическом ретикулуме» (ko04141, 727 unigenes), «транспорте РНК» (ko03013, 618 unigenes) и «spliceosome» ( ko03040, 616 униген). Другие важные пути, связанные с абиотическим стрессом, включают «метаболизм аргинина и пролина» (ko00330), «передачу сигнала растительного гормона» (ko04075), «метаболизм глутатиона» (ko00480), «биосинтез флавоноидов» (ko00941), «биосинтез каротиноидов» (ko009090). ) и так далее.

    Идентификация ДЭТ в условиях солевого стресса у хризантемы

    Здесь мы использовали метод выравнивания по сходству последовательностей для расчета уровня экспрессии каждого транскрипта в двух образцах. Кроме того, дифференциальный анализ экспрессии проводился в соответствии со значением распространенности экспрессии. В общей сложности мы идентифицировали 126 646 DET между обработанными солью и контрольными образцами, и было 60 685 DET с повышенной и 65 961 пониженной регуляцией при солевом стрессе. На основе значения уровня экспрессии (RPKM) уровни экспрессии генов двух образцов показаны на фиг.6.

    Рис. 6. Уровень экспрессии гена хризантемы между двумя библиотеками (Sample_0510_control и Sample_0510_treat).

    Красные точки представляют собой транскрипты, более распространенные в библиотеке обработанных солью, зеленые точки показывают те, которые присутствуют с меньшей частотой в обработанных солью хризантемах, а синие точки обозначают транскрипты, которые существенно не изменились.

    https://doi.org/10.1371/journal.pone.0159721.g006

    Для дальнейшей оценки надежности результатов секвенирования Illumina были отобраны десять транскриптов дифференциальной экспрессии для выполнения qRT-PCR на основе их прогнозируемых функций, таких как транскрипция факторы (MADS, MYB, WRKY, AP2, TAG), солевой транспортер (транспортеры АТФ-связывающей кассеты (ABC)), гормональный фактор (фактор связывания чувствительного элемента ABA), ключевой регуляторный фермент, участвующий в биосинтезе пролина ( P5CS, дельта-1-пирролин-5-карбоксилатсинтетаза), ген, кодирующий PFK1 (6-фосфофруктокиназу 1).Как видно, был один ген с неизвестной функцией. Результаты эксперимента кПЦР и РНК-секвенирования были согласованными (рис. 7).

    Рис. 7. Относительные уровни экспрессии десяти DET между RNA-seq и qRT-PCR в хризантеме.

    Относительные уровни экспрессии генов определяли с помощью 2 -ΔΔCT в выраженном виде. Уровни транскрипта были нормализованы до уровня экспрессии UBC. Планки погрешностей SE из трех независимых повторов.

    https://doi.org/10.1371 / journal.pone.0159721.g007

    Обогащенный анализ DET базами данных GO и KEGG

    Обогащенный анализ транскриптов хризантем с помощью базы данных GO помог нам понять функцию этих DET, и было обогащено 638 ​​терминов GO (значение P ≤ 0,01). «Связывание АТФ» (9 005 DET), за которым следуют «мембрана» (7 086 DET), «интеграция с мембраной» (6 113 DET), «окислительно-восстановительный процесс» (5 244 DET) и «метаболический процесс» (5 041 DET). Другими высокообогащенными терминами ГО, относящимися к стрессу, были «оксидоредуктазная активность», «защитный ответ», «протеинкиназная активность» и «протеин-серин / треонинкиназная активность».Это следствие указывает на то, что термины GO, включая DET, могут занимать важное место в молекулярном механизме солеустойчивости хризантем. Гормоны растений играют функциональную роль в ответе растений на биотические и абиотические стрессы [39]. В нашем исследовании термины GO относятся к растительным гормонам, включая «процесс биосинтеза абсцизовой кислоты», «активность гиббереллин-3-бета-диоксигеназы», ​​«активность жасмонат-O-метилтрансферазы», ​​«процесс биосинтеза этилена», «процесс метаболизма цитокининов» и «брассиностероид». биосинтетический процесс », каждый из которых был обогащен как повышающей, так и понижающей регуляцией.Первое открытие означало, что вторичные метаболиты растений широко участвуют в физиологических процессах растений, таких как рост, развитие и защита [40, 41]. Тем не менее, термины GO, относящиеся к вторичным метаболитам растений в этом исследовании, включая «процесс метаболизма терпеноидов», «процесс биосинтеза флавоноидов», «процесс катаболизма лигнина», «процесс метаболизма органических кислот» и «процесс метаболизма алкалоидов» и так далее. Кроме того, термин GO «катаболический процесс хлорофилла» был активирован, в то время как «процесс биосинтеза хлорофилла» был подавлен.Это может быть связано с нарушением механизма фотосинтеза растений при солевом стрессе.

    Кроме того, мы подтвердили пути, сопоставив DET с терминами в базе данных KEGG. 92 пути были значительно обогащены (значение P ≤0,01) среди всех 278 дифференциально экспрессируемых путей. «Рибосома» была наиболее обогащенным путем (1821 DET). Другие важные пути, связанные с абиотическим стрессом, включая «передачу сигнала растительного гормона», «биосинтез сесквитерпеноидов», «биосинтез флавоноидов», «метаболизм альфа-линоленовой кислоты», «биосинтез фенилпропаноидов» и другие пути.

    Возможные биологические пути воздействия солевого стресса

    Мы проанализировали биохимические пути, на которые влияет солевой стресс, на основе профилей экспрессии. Основные идентифицированные пути развития хризантем показаны в таблице S1.

    Накопление флавоноидов является признаком стресса растений [42]. В этом исследовании было 133 DET с аннотацией KEGG в пути биосинтеза флавоноидов. Кроме того, каскады передачи сигнала опосредуют восприятие и обработку стимулов [43], а «путь передачи сигнала MAPK», «путь передачи сигнала кальция», «путь передачи сигнала PPAR» и «передача сигнала гормона растений» были аннотированы DET.

    У растений каротиноиды в основном находятся в хлоропластах растений и хромопластах цветов и плодов, две важные функции в фотосинтезе растений — участие в поглощении света и предотвращение фотоокисления в клетках-предшественниках [44, 45]. Между тем каротиноиды также являются предшественниками сигнальных молекул растений и могут реагировать на внешние раздражители [46]. Некоторые сообщения показали, что каротиноиды могут участвовать не только в процессе биосинтеза растительных гормонов, таких как абсцизовая кислота и стриголактон [47], но также в синтезе защитных химических веществ [48].Каротиноиды можно рассматривать как поглотители свободных радикалов, а затем уменьшать вред от стресса [48]. В нашем исследовании ключевой фермент «фитоенсинтаза» (crtB, EC: 2.5.1.32), «бета-кольцевая гидроксилаза» (crtR-b, EC: 1.14.-.-) и «бета-каротин-3-гидроксилаза» ( crtZ, EC: 1.14.13.129) в «пути биосинтеза каротиноидов» были обнаружены с повышенной регуляцией. Было показано, что в рапсе и томате фитоенсинтаза является ферментом, ограничивающим скорость биосинтеза каротиноидов [49, 50]. Увеличение содержания фитоинсинтазы обеспечило достаточное количество синтетического субстрата, так что β-каротин и зеаксантин накапливались, а затем представлялись в повышенном количестве.В пути биосинтеза каротиноидов 9-цис-эпоксикаротиноид диоксигеназа является прямым субстратом для синтеза фитогормона абсцизовой кислоты (ABA) [51]. Мы обнаружили, что «8′-гидроксилаза абсцизовой кислоты» (EC: 1.14.13.93), «абсцизовая кислота-альдегидоксидаза» (EC: 1.2.3.14) и «9-цис-эпоксикаротиноид диоксигеназа» (EC: 1.13.11.51) все были с повышенным регулированием. Таким образом, изменения содержания и состава каротиноидов могут привести к изменениям физиологии и биохимии растений.

    Чувствительные и сигнальные гены, участвующие в реакции на солевой стресс

    Ионный сигнальный путь является важным компонентом передачи сигнала солевого стресса, а устойчивость растений к соли в некоторой степени связана с экспрессией и изменениями активности переносчиков ионов, таких как Na + , K + , H + и Ca 2+ [6].Кроме того, изменение активности V-АТФазы определяет выживаемость растительных клеток в условиях стресса [52]. Среди генов переноса ионов: 16 Ca 2+ / H + антипортер (12 с усиленной регуляцией и 4 с пониженной регуляцией), 2 симпортера Na + (все с повышенной регуляцией) и 111 V-типа H + -АТФаза (75 положительная и 36 отрицательная) экспрессировались по-разному,

    Ca 2+ является одним из очень важных повсеместных вторичных мессенджеров в путях передачи сигналов, и обычно его концентрация увеличивается в ответ на стимулы, включая сигналы стресса [53].В предыдущих исследованиях гены, относящиеся к сигнальному пути Ca 2+ , также играли важную роль в реакции риса на различные стрессы окружающей среды [54], Arabidopsis thaliana [55], Chrysanthemum nankingense [36] и так далее. В общей сложности было обнаружено, что 51 ген активируется, в то время как 100 генов, как было установлено, не регулируются в сигнальном пути Ca 2+ (таблица S2). Сигнальный путь Ca 2+ включает многих участников, таких как кальмодулин, обменник кальция, кальций-связывающий белок, кальций-зависимые протеинкиназы (CDPK) и CDPK, являющиеся уникальными сенсорами Ca 2+ у высших растений [54].Более того, сообщалось, что AtCPK4 и AtCPK11 [56], OsCDPK7 [57] придают стрессоустойчивость. В этом исследовании было 28 CDPK с повышенной активностью и 18 с пониженной регуляцией (log 2 -кратное изменение ≥ 1). Гены чувствительности и передачи сигналов солевого стресса также находятся под влиянием других протеинкиназ [58]. Основные дифференциально экспрессируемые протеинкиназы показаны в таблице S3. Активированные митогеном протеинкиназы (MAPK) могут активироваться при абиотических стрессах у растений [59]. Сам каскад MAPK формируется тремя основными составляющими: киназой MAPK-киназы (MAP3K), MAPK-киназой (MAP2K) и MAPK [60].MAPK, такие как ZmSIMK1 [61], OsMPK44 [62], MKKK20 [63], связаны с солеустойчивостью растений. В каскаде MAPK участвовало 12 активированных (log 2 -кратное изменение ≥ 1) и 34 подавляемых (log 2 -кратное изменение ≤ -1). Из них только 6 генов MAPKKK и 3 гена MAPKK были активированы, и все три гена MAPK были активированы. Протеинфосфатаза 2C (PP2C), которая представляет собой Mn 2+ — или Mg 2+ — зависимый протеин серин / треонинфосфатаза, играет ключевую роль в процессах передачи сигнала ABA растений [64, 65].В этом исследовании мы идентифицировали 121 дифференциально экспрессируемый ген серин / треонин-протеинкиназ. И было 80 генов PP2C с повышенной регуляцией (log 2 -кратное изменение ≥ 1) и только 7 с пониженной регуляцией (log 2 -кратное изменение ≤ -1). Прежде всего, было обнаружено 6 генов PP2C, значительно дифференциально экспрессируемых (log 2 -кратное изменение ≥ 10). Дифференциально экспрессируемые PP2C показаны в таблице S4.

    Факторы транскрипции, зависимые от засоления.

    Факторы транскрипции действуют как вышестоящие регуляторы, регулируя экспрессию генов в метаболических путях [15].В этом исследовании мы идентифицировали более шести основных факторов транскрипции (MYB, MYC, WRKY, AP2 / ERF, HD-zip, E2F, цинковый палец и т. Д.), Которые, как известно, являются генами, связанными со стрессом. Основные факторы транскрипции с повышенной или пониженной регуляцией показаны в таблице S5. Белки MYB были самой большой группой в нашем исследовании, которые играют регуляторную роль в процессах развития и защитных реакциях у растений [66] и были обнаружены у Arabidopsis [66], пшеницы [67], риса [66] и других растений. В наших данных DET было 126 активированных и 92 подавленных транскриптов MYB.И другие исследования также сообщили, что факторы транскрипции WRKY [68], AP2 / ERF [69] и HD-zip [70] вместе опосредуют солевой ответ. TOC1 является членом семейства регуляторов псевдоответа (PRR), а TOC1 является многодоменным сигнальным компонентом циркадных часов растений [71]. TOC1 регулирует суточную экспрессию связанного с ABA гена ABAR / CHLH / GUN5 путем прямого связывания с его промотором [72]. В нашем исследовании было обнаружено 13 генов семейства PRR с повышенной регуляцией, включая гомолог TOC1. В этой статье было обнаружено, что белки TGA регулируются вверх (18) или вниз (16), и что белок TGA является членом фактора транскрипции bZIP, который регулирует экспрессию некоторых чувствительных к стрессу генов [73].Эти по-разному экспрессируемые гены могут помочь в изучении солеустойчивости хризантем.

    границ | Факторы транскрипции NAC в ответах растений на множественные абиотические стрессы: успехи и перспективы

    Введение

    Как сидячие организмы, растения постоянно страдают от широкого спектра экологических стрессов, включая абиотические и биотические стрессы. Абиотические стрессы, такие как засуха, засоление, жара и холод, отрицательно влияют на рост растений и продуктивность сельского хозяйства и вызывают ежегодно более 50% всемирной потери урожая основных культур (Boyer, 1982; Bray et al., 2000; Шао и др., 2009; Ахуджа и др., 2010; Lobell et al., 2011). Кроме того, растения также подвергаются нападениям широкого спектра вредителей и патогенов, включая грибы, бактерии, вирусы, нематоды и травоядные насекомые (Hammond-Kosack and Jones, 2000). Кроме того, современные модели прогнозирования климата указывают на ухудшение климата, включая повышение средней температуры, изменение распределения годовых осадков, повышение уровня моря и т. Д. Это будет одновременно с учащением засух, наводнений, аномальной жары и засоления (Истерлинг и др., 2000; МГЭИК, 2007, 2008; Миттлер и Блюмвальд, 2010). Изменение климата также повлияет на распространение вредителей и патогенов. Например, повышение температуры может способствовать распространению патогенов (Bale et al., 2002; Luck et al., 2011; Nicol et al., 2011), а многие абиотические стрессы могут ослабить защитный механизм растений и повысить их восприимчивость к патогенам. инфекции (Amtmann et al., 2008; Goel et al., 2008; Mittler, Blumwald, 2010; Atkinson and Urwin, 2012). Взятые вместе, культурные растения столкнутся с большим количеством и разнообразием экологических стрессов, которые могут возникать одновременно.Поэтому очень срочно разводить стрессоустойчивые сорта сельскохозяйственных культур, чтобы удовлетворить растущий спрос на продуктивность питания в связи с увеличением мирового населения (Takeda and Matsuoka, 2008; Newton et al., 2011).

    Чтобы справиться с этими повторяющимися стрессами окружающей среды, растения могут активировать ряд защитных механизмов, которые включают восприятие сигнала, передачу сигнала через АБК-зависимые или независимые от АБК пути, экспрессию генов, чувствительную к стрессу, и, в свою очередь, активацию физиологических и метаболических реакций. (Xiong et al., 2002; Чавес и др., 2003; Ямагути-Шинозаки и Шинозаки, 2006 г .; Perez-Clemente et al., 2013). На сегодняшний день у многих растений, включая арабидопсис и рис, идентифицирован большой набор генов, чувствительных к стрессу. Эти гены обычно делятся на два типа (Shinozaki et al., 2003). Один из них — это функциональные гены, кодирующие важные ферменты и метаболические белки (функциональные белки), такие как фермент детоксикации, водный канал, белок позднего эмбриогенеза (LEA), которые непосредственно защищают клетки от стрессов.Другой — это регуляторные гены, кодирующие различные регуляторные белки, включая факторы транскрипции (TF) и протеинкиназы, которые регулируют передачу сигнала и экспрессию генов в ответ на стресс. В процессах передачи сигнала TF играют ключевую роль в преобразовании восприятия стрессового сигнала в чувствительную к стрессу экспрессию генов. TF и взаимодействующие с ними цис-элементы функционируют в промоторной области различных связанных со стрессом генов, выступая в качестве молекулярных переключателей для экспрессии генов.У растений ~ 7% генома кодирует предполагаемые ТФ, которые часто принадлежат к большим семействам генов, таким как семейства WRKY, bZIP, MYB, AP2 / EREBP и NAC (Udvardi et al., 2007; Golldack et al., 2011 ). В свете ключевой важности TF в управлении широким спектром последующих событий, большое количество исследований было направлено на выявление и характеристику различных TF, участвующих в реакции на стресс. Однако эти исследования в основном были сосредоточены на понимании реакции модельных растений и сельскохозяйственных культур на один стресс, такой как засуха, засоление, жара или холод, инфекция патогенными микроорганизмами и т. Д. (Hirayama and Shinozaki, 2010; Chew and Halliday, 2011).В отличие от контролируемых условий в лаборатории, сельскохозяйственные культуры и другие растения часто одновременно подвергаются множественным стрессам в полевых условиях (Ahuja et al., 2010). Недавние исследования показали, что реакция растений на комбинацию засухи и жары не является простым аддитивным эффектом отдельного стресса, а комбинация множественных стрессов создает уникальный паттерн экспрессии генов, который отличается от изучения любого стресса по отдельности ( Рижский и др., 2002, 2004; Праш, Зонневальд, 2013; Расмуссен и др., 2013). Таким образом, результаты исследований, проведенных при индивидуальных стрессовых факторах, не подходят для сложных полевых условий, и очень важно охарактеризовать реакцию растений на множественные стрессы и идентифицировать несколько генов, реагирующих на стресс, путем одновременного наложения нескольких стрессов как совершенно новый стресс ( Миттлер, 2006). Возможно, манипуляции с этими множественными генами, чувствительными к стрессу, особенно с многофункциональными ТФ, предоставят возможность вывести устойчивые к широкому спектру культур культуры с высокими урожаями.Основываясь на вышеизложенных соображениях, в данной статье рассматривается прогресс NAC TFs, участвующих в реакции растений на абиотический стресс, а также предлагается направление будущих исследований для решения проблемы множественных экологических стрессов в сельском хозяйстве, особенно в отношении их потенциального использования для устойчивости растений к множественному стрессу в сельском хозяйстве. полевые условия.

    Факторы транскрипции NAC в растениях

    Как одно из самых крупных семейств TF у растений, TF NAC составляют сложное суперсемейство, специфичное для растений, и присутствуют в широком диапазоне видов.Аббревиатура NAC происходит от трех наиболее ранних охарактеризованных белков с определенным доменом (доменом NAC) петунии NAM (без апикальной меристемы), Arabidopsis ATAF1 / 2 и CUC2 (чашеобразные семядоли; Souer et al., 1996; Aida et al. , 1997). Благодаря доступности постоянно растущего числа полных геномов растений и последовательностей EST, большое количество предполагаемых генов NAC было идентифицировано у многих секвенированных видов в масштабе всего генома (как показано в таблице 1), например, 117 у Arabidopsis, 151 в рисе, 74 в винограде, 152 в сое, 204 в пекинской капусте, 152 в кукурузе и так далее.Большой размер семейства NAC неизбежно усложняет распутывание их регуляторного процесса.

    Таблица 1. Семейство NAC у различных видов растений.

    Было обнаружено, что семейство NAC участвует в различных процессах, включая апикальную меристему побегов (Takada et al., 2001), развитие цветков (Sablowski and Meyerowitz, 1998), деление клеток (Kim et al., 2006), старение листьев (Breeze et al., 2011), формирование вторичных стенок (Zhong et al., 2010), а также ответы на биотический и абиотический стресс (Olsen et al., 2005; Кристиансон и др., 2010; Тран и др., 2010; Накашима и др., 2012). Тем не менее, на сегодняшний день охарактеризовано лишь несколько из этих генов, а большинство членов семейства NAC еще не изучено, хотя эти гены, вероятно, играют важную роль в растениях, и потребуется большая работа для определения специфическая биологическая функция каждого гена NAC. Интенсивное исследование модельных растений, включая арабидопсис и рис, показывает, что типичный белок NAC содержит высококонсервативный N-концевой ДНК-связывающий домен NAC и вариабельную регуляторную область транскрипции в C-концевой области.Домен NAC с ~ 150–160 аминокислотами разделен на пять субдоменов (от A до E; Ooka et al., 2003). Функция домена NAC была связана с ядерной локализацией, связыванием ДНК и образованием гомодимеров или гетеродимеров с другими белками, содержащими домен NAC (Olsen et al., 2005). Напротив, сильно разветвленная С-концевая область функционирует как регуляторная область транскрипции, действуя как активатор транскрипции или репрессор, но она часто имеет простые аминокислотные повторы и области, богатые серином и треонином, пролином и глутамином или кислотными остатками. (Olsen et al., 2005; Пураник и др., 2012). Некоторые ТФ NAC также содержат трансмембранные мотивы в С-концевой области, которые отвечают за прикрепление к плазматической мембране или эндоплазматическому ретикулуму, и эти ТФ NAC связаны с мембраной и обозначаются как NTL (Seo et al., 2008; Seo and Park, 2010 ).

    Экспрессия генов NAC может, во-первых, регулироваться на уровне транскрипции, поскольку в промоторной области содержатся некоторые стресс-ответные цис-действующие элементы, такие как ABRE (ABA-чувствительные элементы), DRE (элементы, реагирующие на дегидратацию), жасмоний. элемент, реагирующий на кислоту и элемент, реагирующий на салициловую кислоту.Затем сложная посттранскрипционная регуляция включает опосредованное микроРНК расщепление генов или альтернативный сплайсинг. TF NAC также подвергаются интенсивной посттрансляционной регуляции, включая убиквитинизацию, димеризацию, фосфорилирование или протеолиз (Nakashima et al., 2012; Puranik et al., 2012). Эти меры регулирования помогают ТФ НАК играть несколько ролей в большинстве производственных процессов, как упоминалось выше. TF NAC регулируют транскрипцию нижестоящих генов-мишеней путем связывания с консенсусной последовательностью в их промоторах.Последовательность распознавания NAC (NACRS), содержащая мотив связывания ядер CACG с ДНК, была идентифицирована в промоторе гена, индуцируемого засухой РАННЕГО ОТВЕТА НА DEHYDRATION1 (ERD1) у Arabidopsis (Simpson et al., 2003; Tran et al., 2004) . Индуцируемые засухой ТФ ONAC риса также могут связываться с аналогичными NACRS, демонстрируя, что NACRS может сохраняться у всех растений, по крайней мере, для индуцируемых стрессом ТФ NAC (Hu et al., 2006; Fang et al., 2008). Кроме того, сообщалось о других последовательностях в качестве сайтов связывания NAC (NACBS), таких как кальмодулин-связывающий NAC Arabidopsis с GCTT в качестве основного связывающего мотива (Kim et al., 2007), реагирующий на дефицит железа мотив IDE2, содержащий основную последовательность CA (A / C) G (T / C) (T / C / A) (T / C / A) (Ogo et al., 2008) и элемент, связывающий NAC вторичной стенки (SNBE) с (T / A) NN (C / T) (T / C / G) TNNNNNNNA (A / C) GN (A / C / T) (A / T) в качестве согласованной последовательности (Чжун и др., 2010). Последовательности, фланкирующие основной сайт в промоторе генов-мишеней, могут определять специфичность связывания различных ТФ NAC. Таким образом, семейство NAC TF может распознавать широкий спектр ДНК-связывающих последовательностей и регулировать несколько нижестоящих генов-мишеней.Эти гены-мишени, регулируемые ТФ NAC, включают регуляторные гены, кодирующие регуляторные белки, которые участвуют в передаче сигналов и регуляции экспрессии генов, и функциональные гены, кодирующие белки, которые участвуют в продукции осмолита, улавливании и детоксикации активных форм кислорода, защите макромолекул и убиквитинизации (Puranik et al. ., 2012). Взятые вместе, наличие NACRS в промоторе некоторых из этих генов делает их потенциальными прямыми мишенями, тогда как те, у которых нет этого мотива, могут не быть прямыми мишенями.В будущем еще предстоит выяснить другие новые NACRS с помощью микрочипов в сочетании с иммунопреципитацией хроматина (Taverner et al., 2004).

    Функции факторов транскрипции NAC при абиотическом стрессе

    TF NAC играют жизненно важную роль в сложных сигнальных сетях во время стрессовых реакций растений. Из-за большого количества NAC TF из разных растений и их неизвестной роли по-прежнему остается большой проблемой раскрыть их роль в абиотическом стрессе. Недавно профилирование экспрессии всего генома и исследования транскриптома позволили исследователям идентифицировать ряд предполагаемых TF NAC, участвующих в реакциях на абиотический стресс.Например, 33 гена NAC значительно изменились у Arabdopsis при обработке солью (Jiang and Deyholos, 2006), 38 генов NAC участвовали в реакции на засуху у сои (Le et al., 2011), 40 генов NAC ответили на засуху или солевой стресс. у риса (Fang et al., 2008) 32 гена NAC отреагировали как минимум на два вида обработки Chrysanthemum lavandulifolium (Huang et al., 2012). Оказывается, что значительная часть генов NAC функционирует в ответ на стресс, согласно данным экспрессии, полученным в результате полногеномного анализа транскриптомов у многих растений.Филогенетический анализ NAC TFs показал, что большинство стресс-зависимых NAC TF, по-видимому, содержат близко гомологичный домен NAC (Ernst et al., 2004; Fang et al., 2008). Более того, чувствительные к стрессу гены NAC демонстрируют большое разнообразие паттернов экспрессии, что указывает на их участие в регуляции широкого спектра ответов на различные абиотические стрессы. Точные регуляции генов NAC во время реакций растений на абиотический стресс вносят вклад в создание сложных сигнальных сетей, а важная роль генов NAC в ответах растений на абиотический стресс делает их многообещающими кандидатами для создания устойчивых к стрессу трансгенных растений.Функциональные исследования TF NAC с помощью методов сверхэкспрессии напрямую улучшат наше понимание регуляторных функций членов NAC в отношении абиотических стрессов. Трансгенные конструкции, сверхэкспрессирующие выбранные гены NAC, были созданы в Arabidopsis, рисе и других растениях. Некоторые успешные примеры приведены в таблице 2.

    Таблица 2. Устойчивость к абиотическому стрессу трансгенных растений, сверхэкспрессирующих гены NAC.

    Выводы и перспективы

    Значительный объем информации был получен о TF NAC с момента открытия TF NAC, но исследования в этой области все еще находятся в зачаточном состоянии.Полногеномная идентификация и профилирование экспрессии, несомненно, откроют новые возможности для описания ключевых характеристик NAC TF. В результате наше текущее понимание регуляторных функций NAC TFs у различных видов растений определенно улучшится. В частности, стресс-чувствительные ТФ НАК могут быть использованы в качестве перспективных кандидатов для создания стрессоустойчивых трансгенных растений, обладающих высокой продуктивностью в неблагоприятных условиях. Фактически, многие трансгенные исследования оказались успешными с помощью генных манипуляций с ТФ NAC для придания растениям устойчивости к различным стрессам (как показано в таблице 2), но все еще остаются некоторые проблемы, которые необходимо решить.Во-первых, конститутивная сверхэкспрессия генов NAC иногда может приводить к негативным эффектам у трансгенных растений, таким как карликовость, позднее цветение и снижение урожайности (Fujita et al., 2004; Nakashima et al., 2007; Hao et al., 2011; Liu et al., 2011; Liu et al. др., 2011б). Во-вторых, трансгенные растения, сверхэкспрессирующие гены NAC, могут иногда иметь антагонистические ответы на различные стрессы. Например, засухоустойчивые растения Arabidopsis, сверхэкспрессирующие ATAF1, были очень чувствительны к АБК, высокосолевому, окислительному стрессу и некротрофным грибам (B.cinerea; Wu et al., 2009). Сверхэкспрессия ANAC019 и ANAC055 не только увеличивала засухоустойчивость, но и снижала устойчивость к B. cinerea (Fujita et al., 2004; Bu et al., 2008). В-третьих, только несколько трансгенных растений, сверхэкспрессирующих гены NAC, были оценены в полевых испытаниях до сих пор, и большинство из них было протестировано в тепличных условиях и сосредоточено на вегетативных стадиях растений, а не на репродуктивных стадиях (Valliyodan and Nguyen, 2006). Наконец, в большинстве исследований ТФ NAC изучались только молекулярные механизмы возникающих отдельных стрессовых ситуаций.Хотя в недавних исследованиях были проведены многопараллельные стрессовые эксперименты и выявлены различные ТФ NAC, реагирующие на одиночные стрессовые ситуации (Huang et al., 2012), знаний о реакциях на комбинации нескольких стрессовых факторов, особенно взаимодействия между стрессовыми факторами, недостаточно.

    Как всем известно, одной из наиболее важных целей исследования стресса растений является определение целей по повышению устойчивости сельскохозяйственных культур к стрессу. С учетом прогнозируемых изменений климатических условий, ведущих к более сложной стрессовой среде на полях, мы столкнемся с новыми проблемами в создании устойчивых к множественным стрессам культур.Селекция таких растений будет зависеть от понимания важнейших сетей регуляции стресса и потенциальных эффектов различных комбинаций неблагоприятных условий. Исследования множественных реакций на стресс у Arabidopsis предоставили нам несколько возможных путей. Основные регуляторные гены, такие как члены семейств MYC, MYB и NAC TF, которые действуют в ответах на множественные абиотические стрессы, являются отличными кандидатами для манипулирования толерантностью к множественному стрессу. Таким образом, в будущем крайне важно накладывать несколько напряжений одновременно, которые моделируют естественные полевые условия, и рассматривать каждый набор комбинаций напряжений как совершенно новое напряжение, чтобы идентифицировать соответствующие переходные напряжения NAC, обычно вызываемые множественными напряжениями.Манипуляции с этими генами должны быть основной целью попыток получить растения с повышенной устойчивостью к множественным стрессам. Кроме того, потенциальные гены NAC, которые придают устойчивость к множественным абиотическим стрессам у модельных видов растений, должны быть протестированы на культурных растениях, и больший акцент следует сделать на полевой оценке трансгенных культур, несущих гены NAC, особенно с акцентом на их репродуктивный успех. Другим уроком является выбор и / или улучшение подходящих промоторов (таких как индуцируемый стрессом промотор), которые могут максимизировать положительные эффекты и минимизировать отрицательные эффекты, вызванные чрезмерной экспрессией некоторых генов NAC.Таким образом, TF NAC являются ключевыми компонентами сигнального пути в ответ на стресс, которые выполняют свою функцию, взаимодействуя как с нижележащими, так и с вышестоящими партнерами (Рисунок 1). Понимание молекулярных механизмов сетей NAC TF, объединяющих множественные реакции на стресс, будет иметь важное значение для развития культурных растений, устойчивых к стрессу широкого спектра действия, которые могут лучше справляться с экологическими проблемами в будущем климате.

    Рисунок 1. Схематическая диаграмма NAC TF как ключевых компонентов в сетях регуляции транскрипции во время абиотического стресса.NACRS — это последовательность распознавания NAC.

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Это исследование было поддержано Ключевой лабораторией биоресурсов засоленных почв Цзянсу (JKLBS2014006), Национальной программой фундаментальных исследований Китая (2013CB430403), Национальным фондом естественных наук Китая (41171216), Цзянсуским автономным инновационным проектом сельскохозяйственных наук и технологий [ CX (15) 1005], Фонд естественных наук Цзянсу, Китай (BK20151364), Yantai Double-100 Talent Plan (XY-003-02) и135 План развития YIC-CAS.

    Список литературы

    Ахуджа, И., де Вос, Р. К., Бонс, А. М., и Холл, Р. Д. (2010). Реакции растений на молекулярный стресс сталкиваются с изменением климата. Trends Plant Sci. 15, 664–674. DOI: 10.1016 / j.tplants.2010.08.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Аида М., Исида Т., Фукаки Х., Фудзисава Х. и Тасака М. (1997). Гены, участвующие в разделении органов у Arabidopsis: анализ чашевидного мутанта семядолей. Растительная клетка 9, 841–857.DOI: 10.1105 / tpc.9.6.841

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Amtmann, A., Troufflard, S., and Armengaud, P. (2008). Влияние калийного питания на устойчивость растений к вредителям и болезням. Physiol. Растение. 133, 682–691. DOI: 10.1111 / j.1399-3054.2008.01075.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бейл, Дж. С., Мастерс, Дж. Дж., Ходкинсон, И. Д., Аумак, К., Беземер, Т. М., Браун, В. К. и др. (2002). Травоядные в исследованиях глобального изменения климата: прямое влияние повышения температуры на насекомых-травоядных.Glob. Сменить Биол. 8, 1–16. DOI: 10.1046 / j.1365-2486.2002.00451.x

    CrossRef Полный текст | Google Scholar

    Брей, Э.А., Бейли-Серрес, Дж., И Веретильник, Э. (2000). «Ответы на абиотические стрессы», в «Биохимии и молекулярной биологии растений», ред. В. Груиссем, Б. Бучаннан и Р. Джонс (Роквилл, Мэриленд: Американское общество физиологов растений), 1158–1249.

    Бриз, Э., Харрисон, Э., МакХэтти, С., Хьюз, Л., Хикман, Р., Хилл, К., и др. (2011). Временное профилирование транскриптов во время старения листьев Arabidopsis с высоким разрешением выявляет четкую хронологию процессов и регуляции.Растительная клетка 23, 873–894. DOI: 10.1105 / tpc.111.083345

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Bu, Q., Jiang, H., Li, C. B., Zhai, Q., Zhang, J., Wu, X., et al. (2008). Роль факторов транскрипции NAC ANAC019 и ANAC055 Arabidopsis thaliana в регуляции защитных реакций, сигнализируемых жасмоновой кислотой. Cell Res. 18, 756–767. DOI: 10.1038 / cr.2008.53

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ченчи, А., Гиньон, В., Ру, Н., и Rouard, M. (2014). Геномный анализ факторов транскрипции NAC в банане (Musa acuminata) и определение ортологических групп NAC для однодольных и двудольных. Завод Мол. Биол. 85, 63–80. DOI: 10.1007 / s11103-013-0169-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чавес, М. М., Мароко, Дж., И Жоао, С. П. (2003). Понимание реакции растений на засуху — от генов до всего растения. Функц. Plant Biol. 30, 239–264. DOI: 10.1071 / FP02076

    CrossRef Полный текст | Google Scholar

    Кристиансон, Дж.А., Деннис, Э. С., Ллевеллин, Д. Дж., И Уилсон, И. В. (2010). Факторы транскрипции ATAF NAC: регуляторы передачи сигналов стресса растений. Сигнал завода. Behav. 5, 428–432. DOI: 10.4161 / psb.5.4.10847

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Истерлинг, Д. Р., Мил, Г. А., Пармезан, К., Чангнон, С. А., Карл, Т. Р., и Мирнс, Л. О. (2000). Экстремальные климатические явления: наблюдения, моделирование и воздействия. Science 289, 2068–2074. DOI: 10.1126 / science.289.5487.2068

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Эрнст, Х.А., Олсен, А. Н., Ларсен, С., Ло Леджо, Л. (2004). Структура консервативного домена ANAC, члена семейства транскрипционных факторов NAC. EMBO Rep. 5, 297–303. DOI: 10.1038 / sj.embor.7400093

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фанг, Ю., Ю, Дж., Се, К., Се, В., и Сюн, Л. (2008). Систематический анализ последовательности и идентификация тканеспецифичных или чувствительных к стрессу генов семейства факторов транскрипции NAC в рисе. Мол. Genet. Геномика 280, 547–563.DOI: 10.1007 / s00438-008-0386-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takagi, M., et al. (2004). Белок NAC, индуцированный дегидратацией, RD26, участвует в новом пути передачи сигналов стресса, зависимого от АБК. Плант Ж. 39, 863–876. DOI: 10.1111 / j.1365-313X.2004.02171.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гоэль, А.К., Лундберг, Д., Торрес, М.А., Мэтьюз, Р., Акимото-Томияма, К., Фармер, Л. и др. (2008). Эффектор Pseudomonas syringae типа III HopAM1 усиливает вирулентность растений, испытывающих водный стресс. Мол. Взаимодействие растений и микробов. 21, 361–370. DOI: 10.1094 / MPMI-21-3-0361

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Golldack, D., Lüking, I., and Yang, O. (2011). Устойчивость растений к засухе и засолению: факторы транскрипции, регулирующие стресс, и их функциональное значение в клеточной транскрипционной сети.Растительная клетка Rep. 30, 1383–1391. DOI: 10.1007 / s00299-011-1068-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ха, К. В., Исфахани, М. Н., Ватанабе, Ю., Тран, У. Т., Сулиман, С., Мочида, К. и др. (2014). Полногеномная идентификация и анализ экспрессии членов семейства CaNAC в нуте во время развития, обезвоживания и лечения ABA. PLoS ONE 9: e114107. DOI: 10.1371 / journal.pone.0114107

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хаммонд-Косак, К.Э. и Джонс, Дж. Д. Г. (2000). «Ответ на патогены растений», в «Биохимии и молекулярной биологии растений», ред. Б. Бучаннан, В. Груиссем и Р. Джонс (Роквилл, Мэриленд: Американское общество физиологов растений), 1102–1157.

    Hao, Y.J., Wei, W., Song, Q.X., Chen, H.W., Zhang, Y.Q., Wang, F., et al. (2011). Факторы транскрипции NAC сои способствуют устойчивости к абиотическому стрессу и образованию боковых корней у трансгенных растений. Плант Ж. 68, 302–313. DOI: 10.1111 / j.1365-313X.2011.04687.х

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хираяма, Т., и Шинозаки, К. (2010). Исследование реакции растений на абиотический стресс в постгеномную эру: прошлое, настоящее и будущее. Плант J. 61, 1041–1052. DOI: 10.1111 / j.1365-313X.2010.04124.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ху, Х., Дай, М., Яо, Дж., Сяо, Б., Ли, X., Чжан, К. и др. (2006). Сверхэкспрессия факторов транскрипции NAM, ATAF и CUC (NAC) повышает устойчивость риса к засухе и солеустойчивость.Proc. Natl. Акад. Sci. США 103, 12987–12992. DOI: 10.1073 / pnas.0604882103

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ху, Р., Ци, Г., Конг, Ю., Конг, Д., Гао, К., и Чжоу, Г. (2010). Комплексный анализ семейства генов фактора транскрипции домена NAC у Populus trichocarpa. BMC Plant Biol. 10: 145. DOI: 10.1186 / 1471-2229-10-145

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ху, В., Вэй, Ю., Ся, З., Янь, Ю., Хоу, X., Zou, M., et al. (2015). Полногеномная идентификация и анализ экспрессии семейства факторов транскрипции NAC в маниоке. PLoS ONE 10: e0136993. DOI: 10.1371 / journal.pone.0136993

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хуанг, Х., Ван, Ю., Ван, С., Ву, X., Янг, К., Ню, Ю. и др. (2012). Транскриптомный обзор и анализ экспрессии стресс-чувствительных генов NAC в Chrysanthemum lavandulifolium. Plant Sci. 193–194, 18–27. DOI: 10.1016 / j.plantsci.2012.05.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    IPCC (2007). «Изменение климата 2007: научная основа», вклад Рабочей группы I в Четвертый оценочный доклад Межправительственной группы экспертов по изменению климата, ред. С. Соломон, Д. Цинь, М. Маннинг, З. Чен, М. Маркиз. , KB Averyt, et al. (Женева: Секретариат МГЭИК).

    IPCC (2008). «Изменение климата и вода», в Техническом документе Межправительственной группы экспертов по изменению климата, ред. Б.К. Бейтс, З. В. Кундзевич, Дж. Палутикоф и С. Ву (Женева: Секретариат МГЭИК).

    Йенсен, М. К., Кьерсгаард, Т., Нильсен, М. М., Гальберг, П., Петерсен, К., О’шеа, К. и др. (2010). Семейство факторов транскрипции NAC Arabidopsis thaliana: взаимосвязь структура-функция и детерминанты передачи сигналов стресса ANAC019. Биохим. J. 426, 183–196. DOI: 10.1042 / BJ200

    PubMed Аннотация | CrossRef Полный текст

    Чжон, Дж. С., Ким, Ю. С., Бэк, К. Х., Юнг, Х., Ha, S.H., Do Choi, Y., et al. (2010). Специфическая для корней экспрессия OsNAC10 улучшает засухоустойчивость и урожайность зерна риса в условиях полевой засухи. Plant Physiol. 153, 185–197. DOI: 10.1104 / стр.110.154773

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Цзян Ю. и Дейхолос М. К. (2006). Комплексное транскрипционное профилирование корней Arabidopsis, подвергшихся стрессу NaCl, позволяет выявить новые классы чувствительных генов. BMC Plant Biol. 6:25. DOI: 10.1186 / 1471-2229-6-25

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ким, Х.С., Пак, Б. О., Ю, Дж. Х., Юнг, М. С., Ли, С. М., Хан, Х. Дж. И др. (2007). Идентификация кальмодулин-связывающего белка NAC в качестве репрессора транскрипции у Arabidopsis. J. Biol. Chem. 282, 36292–36302. DOI: 10.1074 / jbc.M705217200

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ким, Ю.С., Ким, С.Г., Парк, Дж. Э., Парк, Х. Ю., Лим, М. Х., Чуа, Н. Х. и др. (2006). Связанный с мембраной фактор транскрипции NAC регулирует деление клеток арабидопсиса. Растительная клетка 18, 3132–3144.DOI: 10.1105 / tpc.106.043018

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ле Д. Т., Нишияма Р., Ватанабэ Ю., Мочида К., Ямагути-Шинозаки К., Шинозаки К. и др. (2011). Полногеномный обзор и анализ экспрессии семейства растительных факторов транскрипции NAC в сое во время развития и стресса дегидратации. ДНК Res. 18, 263–276. DOI: 10.1093 / dnares / dsr015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лю, К.Л., Сю, К. Д., Чжао, Л. Дж., Пань, Ю. З., Цзян, Б. Б., Чжан, Х. К. и др. (2011a). Сверхэкспрессия нового гена фактора транскрипции NAC хризантемы повышает устойчивость табака к соли. Biotechnol. Lett. 33, 2073–2082. DOI: 10.1007 / s10529-011-0659-8

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Лю, Т. К., Сун, X. М., Дуань, В. К., Хуанг, З. Н., Лю, Г. Ф., Ли, Ю. и др. (2014). Полногеномный анализ и паттерны экспрессии семейства факторов транскрипции NAC на разных стадиях развития и абиотических стрессах у китайской капусты.Завод Мол. Биол. Rep. 32, 1041–1056. DOI: 10.1007 / s11105-014-0712-6

    CrossRef Полный текст | Google Scholar

    Лю X., Хун Л., Ли X. Y., Яо Ю., Ху Б. и Ли Л. (2011b). Повышенная засухо- и солеустойчивость трансгенного Arabidopsis, сверхэкспрессирующего транскрипционный фактор NAC из Arachis hypogaea. Biosci. Biotechnol. Биохим. 75, 443–450. DOI: 10.1271 / bbb.100614

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Удача, Дж., Спакман, М., Freeman, A., Trębicki, P., Griffiths, W., Finlay, K., et al. (2011). Изменение климата и болезни продовольственных культур. Завод Патол. 60, 113–121. DOI: 10.1111 / j.1365-3059.2010.02414.x

    CrossRef Полный текст | Google Scholar

    Лу, М., Ин, С., Чжан, Д. Ф., Ши, Ю. С., Сун, Ю. К., Ван, Т. Ю. и др. (2012). Чувствительный к стрессу фактор транскрипции NAC кукурузы, ZmSNAC1, придает повышенную устойчивость к обезвоживанию трансгенного Arabidopsis. Plant Cell Rep. 31, 1701–1711. DOI: 10.1007 / s00299-012-1284-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мао, X., Чжан, Х., Цянь, X., Ли, А., Чжао, Г., и Цзин, Р. (2012). TaNAC2, фактор транскрипции пшеницы NAC-типа, обеспечивающий повышенную устойчивость к множественным абиотическим стрессам у Arabidopsis. J. Exp. Бот. 63, 2933–2946. DOI: 10.1093 / jxb / err462

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Mittler, R., and Blumwald, E. (2010). Генная инженерия в современном сельском хозяйстве: проблемы и перспективы. Анну. Rev. Plant Biol. 61, 443–462. DOI: 10.1146 / annurev-arplant-042809-112116

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Накашима, К., Такасаки, Х., Мизои, Дж., Шинозаки, К., и Ямагути-Шинозаки, К. (2012). Факторы транскрипции NAC в ответах растений на абиотический стресс. Биохим. Биофиз. Acta 1819, 97–103. DOI: 10.1016 / j.bbagrm.2011.10.005

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Накашима, К., Тран, Л.С., ван Нгуен, Д., Фудзита, М., Маруяма, К., Тодака, Д., и др. (2007). Функциональный анализ фактора транскрипции NAC-типа OsNAC6, участвующего в экспрессии генов, чувствительных к абиотическому и биотическому стрессу, в рисе.Плант Ж. 51, 617–630. DOI: 10.1111 / j.1365-313X.2007.03168.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ньютон, А. С., Джонсон, С. Н., и Грегори, П. Дж. (2011). Последствия изменения климата для болезней, урожайности и продовольственной безопасности. Euphytica 179, 3–18. DOI: 10.1007 / s10681-011-0359-4

    CrossRef Полный текст | Google Scholar

    Никол, Дж. М., Тернер, С. Дж., Койн, Д. Л., Найс, Л. Д., Хокленд, С., и Маафи, З. Т. (2011). «Современные нематодные угрозы мировому сельскому хозяйству», в «Геномике и молекулярной генетике взаимодействий растений и нематод», под ред. Дж.Джонс, Г. Гейзен и К. Фенолл (Берлин: Springer), 21–43. DOI: 10.1007 / 978-94-007-0434-3_2

    CrossRef Полный текст

    Нуруззаман М., Манимекалай Р., Шарони А. М., Сато К., Кондо Х., Оока Х. и др. (2010). Полногеномный анализ семейства факторов транскрипции NAC риса. Gene 465, 30–44. DOI: 10.1016 / j.gene.2010.06.008

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ого, Ю., Кобаяси, Т., Наканиси Итаи, Р., Наканиши, Х., Какей, Ю., Такахаши М. и др. (2008). Новый фактор транскрипции NAC, IDEF2, который распознает чувствительный к дефициту железа элемент 2, регулирует гены, участвующие в гомеостазе железа у растений. J. Biol. Chem. 283, 13407–13417. DOI: 10.1074 / jbc.M708732200

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Olsen, A. N., Ernst, H.A., Leggio, L. L., and Skriver, K. (2005). Факторы транскрипции NAC: структурно различны, функционально разнообразны. Trends Plant Sci. 10, 79–87.DOI: 10.1016 / j.tplants.2004.12.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Оока, Х., Сато, К., Дои, К., Нагата, Т., Отомо, Ю., Мураками, К., и др. (2003). Комплексный анализ генов семейства NAC у Oryza sativa и Arabidopsis thaliana. ДНК Res. 10, 239–247. DOI: 10.1093 / dnares / 10.6.239

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Перес-Клементе, Р. М., Вивес, В., Зандалинас, С. И., Лопес-Климент, М. Ф., Муньос, В., и Гомес-Каденас, А. (2013). Биотехнологические подходы к изучению реакции растений на стресс. Biomed Res. Int. 2013: 654120. DOI: 10.1155 / 2013/654120

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Праш, К. М., Зонневальд, У. (2013). Одновременное воздействие тепла, засухи и вируса на растения Arabidopsis обнаруживает значительные сдвиги в сигнальных сетях. Plant Physiol. 162, 1849–1866. DOI: 10.1104 / стр.113.221044

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пураник, С., Саху, П. П., Мандал, С. Н., Б., В. С., Парида, С. К., и Прасад, М. (2013). Комплексное полногеномное исследование, геномная структура и профили экспрессии семейства факторов транскрипции NAC у лисохвоста проса (Setaria italica L.). PLoS ONE 8: e64594. DOI: 10.1371 / journal.pone.0064594

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Пураник С., Саху П. П., Шривастава П. С. и Прасад М. (2012). Белки NAC: регуляция и роль в толерантности к стрессу. Trends Plant Sci.17, 369–381. DOI: 10.1016 / j.tplants.2012.02.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рамеговда, В., Сентил-Кумар, М., Натараджа, К. Н., Редди, М. К., Майсур, К. С. и Удаякумар, М. (2012). Экспрессия фактора транскрипции пальчатого проса EcNAC1 в табаке придает устойчивость к абиотическому стрессу. PLoS ONE 7: e40397. DOI: 10.1371 / journal.pone.0040397

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Расмуссен, С., Барах, П., Суарес-Родригес, М.С., Брессендорф, С., Фриис, П., Костантино, П. и др. (2013). Ответы транскриптома на комбинации стрессов у Arabidopsis. Plant Physiol. 161, 1783–1794. DOI: 10.1104 / стр.112.210773

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рижский, Л., Лян, Х., Миттлер, Р. (2002). Комбинированный эффект засухи и теплового шока на экспрессию генов в табаке. Plant Physiol. 130, 1143–1151. DOI: 10.1104 / pp.006858

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рижский, Л., Лян, Х., Шуман, Дж., Шулаев, В., Давлетова, С., Миттлер, Р. (2004). Когда пути защиты сталкиваются. Ответ арабидопсиса на сочетание засухи и теплового стресса. Plant Physiol. 134, 1683–1696. DOI: 10.1104 / стр.103.033431

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Раштон, П. Дж., Боковец, М. Т., Хан, С., Чжан, Х., Браннок, Дж. Ф., Чен, X. и др. (2008). Факторы транскрипции табака: новое понимание регуляции транскрипции у пасленовых.Plant Physiol. 147, 280–295. DOI: 10.1104 / стр.107.114041

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Sablowski, R. W., and Meyerowitz, E. M. (1998). Гомолог NO APICAL MERISTEM является непосредственной мишенью для генов гомеоза цветов APETALA3 / PISTILLATA. Cell 92, 93–103. DOI: 10.1016 / S0092-8674 (00) 80902-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сатиш, В., Джаганнадхам, П. Т., Чидамбаранатхан, П., Джайн, П. К., и Шринивасан, Р.(2014). Гены факторов транскрипции NAC: полногеномная идентификация, филогенетический анализ, анализ мотивов и цис-регуляторных элементов у голубиного гороха (Cajanus cajan (L.) Millsp.). Мол. Биол. Реп. 41, 7763–7773. DOI: 10.1007 / s11033-014-3669-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сео, П. Дж., И Парк, К. М. (2010). Связанный с мембраной фактор транскрипции NAC как интегратор сигналов биотического и абиотического стресса. Сигнал завода. Behav. 5, 481–483. DOI: 10.4161 / psb.11083

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шахнеджат-Бушехри, С., Мюллер-Робер, Б., и Балазаде, С. (2012). Фактор транскрипции NAC арабидопсиса JUNGBRUNNEN1 влияет на гены, связанные с термопамятью, и повышает устойчивость к тепловому стрессу в праймированных и непраймированных условиях. Сигнал завода. Behav. 7, 1518–1521. DOI: 10.4161 / psb.22092

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шан, Х., Ли, В., Цзоу, К., Юань, Ю. (2013). Анализ семейства генов фактора транскрипции NAC в Gossypium raimondii Ulbr: расположение в хромосоме, структура, филогения и паттерны экспрессии.J. Integr. Plant Biol. 55, 663–676. DOI: 10.1111 / jipb.12085

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шао, Х. Б., Чу, Л. Ю., Джалил, К. А., Маниваннан, П., Паннеерселвам, Р., и Шао, М. А. (2009). Понимание вызванных стрессом изменений в основном метаболизме высших растений, вызванных дефицитом воды, — биотехнологическое и устойчивое улучшение сельского хозяйства и экологии в засушливых регионах земного шара. Крит. Rev. Biotechnol. 29, 131–151. DOI: 10.1080 / 07388550

  • 9792

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Шинозаки, К., Ямагути-Шинозакий, К., Секиз, М. (2003). Регуляторная сеть экспрессии генов в ответах на засуху и холодный стресс. Curr. Opin. Plant Biol. 6, 410–417. DOI: 10.1016 / S1369-5266 (03) 00092-X

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ширига К., Шарма Р., Кумар К., Ядав С. К., Хоссейн Ф. и Тирунавуккарасу Н. (2014). Полногеномная идентификация и паттерн экспрессии чувствительных к засухе членов семейства NAC в кукурузе. Мета-ген 2, 407–417.DOI: 10.1016 / j.mgene.2014.05.001

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Симпсон, С. Д., Накашима, К., Нарусака, Ю., Секи, М., Шинозаки, К., и Ямагути-Шинозаки, К. (2003). Два различных новых цис-действующих элемента erd1, гомологичного clpA гена Arabidopsis, действуют как индукция дегидратационным стрессом и индуцированное темнотой старение. Плант Ж. 33, 259–270. DOI: 10.1046 / j.1365-313X.2003.01624.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Синдху, А., Чинтаманани, С., Брандт, А.С., Занис, М., Скофилд, С.Р., и Джохал, Г.С. (2008). Хранитель трав: специфическое происхождение и сохранение уникального гена устойчивости к болезням в линии травы. Proc. Natl. Акад. Sci. США 105, 1762–1767. DOI: 10.1073 / pnas.0711406105

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сингх А. К., Шарма В., Пал А. К., Ачарья В. и Ахуджа П. С. (2013). Полногеномная организация и профили экспрессии семейства факторов транскрипции NAC у картофеля (Solanum tuberosum L.). ДНК Res. 20, 403–423. DOI: 10.1093 / dnares / dst019

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сонг, С. Ю., Чен, Ю., Чен, Дж., Дай, X. Y. и Чжан, В. Х. (2011). Физиологические механизмы, лежащие в основе OsNAC5-зависимой устойчивости растений риса к абиотическому стрессу. Планта 234, 331–345. DOI: 10.1007 / s00425-011-1403-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Souer, E., van Houwelingen, A., Kloos, D., Mol, J., and Koes, R.(1996). Ген отсутствия апикальной меристемы петунии необходим для формирования паттерна у эмбрионов и цветков и экспрессируется на границах меристемы и зачатков. Cell 85, 159–170. DOI: 10.1016 / S0092-8674 (00) 81093-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сперотто, Р. А., Рикаченевский, Ф. К., Дуарте, Г. Л., Бофф, Т., Лопес, К. Л., Сперб, Э. Р. и др. (2009). Идентификация активированных генов в флаговых листьях во время набивки рисового зерна и характеристика OsNAC5, нового ABA-зависимого фактора транскрипции.Planta 230, 985–1002. DOI: 10.1007 / s00425-009-1000-9

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Су, Х. Ю., Чжан, С. З., Инь, Ю. Л., Чжу, Д. З., и Хань, Л. Ю. (2015). Полногеномный анализ семейства факторов транскрипции NAM-ATAF1,2-CUC2 в Solanum lycopersicum. J. Plant Biochem. Biotechnol. 24, 176–183. DOI: 10.1007 / s13562-014-0255-9

    CrossRef Полный текст | Google Scholar

    Су, Х., Чжан, С., Юань, Х., Чен, К., Ван, Х. Ф., и Хао, Ю.J. (2013). Полногеномный анализ и идентификация стресс-чувствительных генов семейства факторов транскрипции NAM-ATAF1,2-CUC2 в яблоке. Plant Physiol. Биохим. 71, 11–21. DOI: 10.1016 / j.plaphy.2013.06.022

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Такада, С., Хибара, К., Исида, Т., и Тасака, М. (2001). Ген COTYLEDON1 Arabidopsis в форме чашки регулирует формирование апикальной меристемы побега. Развитие 128, 1127–1135.

    PubMed Аннотация | Google Scholar

    Тан, Ю., Лю, М., Гао, С., Чжан, З., Чжао, X., Чжао, К. и др. (2012). Молекулярная характеристика новых генов TaNAC в пшенице и сверхэкспрессия TaNAC2a придают табаку засухоустойчивость. Physiol. Растение. 144, 210–224. DOI: 10.1111 / j.1399-3054.2011.01539.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тран, Л. С., Накашима, К., Сакума, Ю., Симпсон, С. Д., Фудзита, Ю., Маруяма, К. и др. (2004). Выделение и функциональный анализ индуцируемых стрессом факторов транскрипции NAC Arabidopsis, которые связываются с цис-элементом, чувствительным к засухе, в промоторе 1, реагирующем на стресс дегидратации.Растительная клетка 16, 2481–2498. DOI: 10.1105 / tpc.104.022699

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Тран, Л. С., Нишияма, Р., Ямагути-Шинозаки, К., и Шинозаки, К. (2010). Возможное использование факторов транскрипции NAC для повышения устойчивости растений к абиотическому стрессу с помощью биотехнологического подхода. ГМ культуры 1, 32–39. DOI: 10.4161 / gmcr.1.1.10569

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Удварди М.К., Какар К., Wandrey, M., Montanari, O., Murray, J., Andriankaja, A., et al. (2007). Факторы транскрипции бобовых: глобальные регуляторы развития растений и реакции на окружающую среду. Plant Physiol. 144, 538–549. DOI: 10.1104 / стр.107.098061

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Валлиодан Б. и Нгуен Х. Т. (2006). Понимание регуляторных сетей и инженерии для повышения устойчивости растений к засухе. Curr. Opin. Plant Biol. 9, 189–195. DOI: 10.1016 / j.pbi.2006.01.019

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван Н., Чжэн Ю., Синь Х., Фанг Л. и Ли С. (2013). Комплексный анализ семейства генов фактора транскрипции домена NAC у Vitis vinifera. Растительная клетка Rep. 32, 61–75. DOI: 10.1007 / s00299-012-1340-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., Yin, B., et al. (2009). Двойная функция Arabidopsis ATAF1 в ответах на абиотический и биотический стресс.Cell Res. 19, 1279–1290. DOI: 10.1038 / cr.2009.108

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Wu, Z., Xu, X., Xiong, W., Wu, P., Chen, Y., Li, M., et al. (2015). Полногеномный анализ семейства генов NAC у физического ореха (Jatropha curcas L.). PLoS ONE 10: e0131890. DOI: 10.1371 / journal.pone.0131890

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сюэ, Г. П., Уэй, Х. М., Ричардсон, Т., Дрент, Дж., Джойс, П. А., и Макинтайр, К.Л. (2011). Сверхэкспрессия TaNAC69 приводит к повышенным уровням транскриптов стресс-активируемых генов и устойчивости к дегидратации у мягкой пшеницы. Мол. Завод 4, 697–712. DOI: 10.1093 / mp / ssr013

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ямагути-Шинозаки, К. и Шинозаки, К. (2006). Сети регуляции транскрипции в клеточных ответах и ​​толерантности к обезвоживанию и холодовым стрессам. Анну. Rev. Plant Biol. 57, 781–803. DOI: 10.1146 / annurev.arplant.57.032905.105444

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Yokotani, N., Ichikawa, T., Kondou, Y., Matsui, M., Hirochika, H., Iwabuchi, M., et al. (2009). Устойчивость к различным стрессам окружающей среды, создаваемым чувствительным к соли геном риса ONAC063 у трансгенного Arabidopsis. Planta 229, 1065–1075. DOI: 10.1007 / s00425-009-0895-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ю, Дж., Чжан, Л., Сун, Б., Ци, X. и Чан, З. (2015).Систематический анализ и идентификация чувствительных к стрессу генов семейства NAC у Brachypodium distachyon. PLoS ONE 10: e0122027. DOI: 10.1371 / journal.pone.0122027

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Zheng, X., Chen, B., Lu, G., and Han, B. (2009). Сверхэкспрессия фактора транскрипции NAC увеличивает засухоустойчивость и устойчивость риса к соли. Биохим. Биофиз. Res. Commun. 379, 985–989. DOI: 10.1016 / j.bbrc.2008.12.163

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Новые свойства и функциональные последствия некодирующей транскрипции

    Abstract

    Геномы эукариот богаты единицами транскрипции, кодирующими «длинные некодирующие РНК» (днРНК).Цель всей этой транскрипции неясна, поскольку большинство днРНК быстро становятся мишенью для разрушения во время синтеза или вскоре после него. По мере продолжения дебатов о функциональном значении многих специфических lncRNAs, растет поддержка представления о том, что во многих случаях функционально важен акт транскрипции, а не сам продукт РНК. В самом деле, этот альтернативный механизм может лучше объяснить, как низкосерийные lncRNAs транскрибируются из-за функции некодирующей ДНК в организмах. Здесь мы выделяем некоторые из недавно появившихся особенностей, которые отличают кодирующую транскрипцию от некодирующей, и обсуждаем, как эти различия могут иметь важные последствия для функциональных последствий некодирующей транскрипции.

    РНК-полимераза II (RNAPII) повсеместно транскрибирует геномы, генерируя все кодирующие белки информационные РНК (мРНК) и многие некодирующие РНК длиной более 200 нуклеотидов (длинные некодирующие РНК; днРНК) (Jensen et al.2013). Сегодня принято считать, что большинство геномов эукариот генерируют множество транскриптов днРНК, но по техническим причинам, обсуждаемым ниже, многие днРНК до недавнего времени не могли быть обнаружены. Следовательно, только относительно небольшая часть днРНК была функционально охарактеризована, в отличие от других классов хорошо охарактеризованных коротких некодирующих РНК, генерируемых RNAPII (например,g., микро РНК, малые интерферирующие РНК, малые ядерные РНК и малые ядрышковые РНК). Тот факт, что lncRNAs определяются своим размером, а не какой-либо общей функцией, сам по себе свидетельствует о том, что это группирование является произвольным и, действительно, относительно мало еще известно о ролях этого гетерогенного класса некодирующих транскриптов.

    На первый взгляд мРНК и днРНК имеют много общих черт. Оба класса транскриптов являются 5′-кэпированными, могут быть мультиэксонными, альтернативно сплайсированными и 3′-полиаденилированными.Однако, в отличие от стабильных зрелых мРНК, которые экспортируются в цитоплазму для синтеза белка, днРНК являются преимущественно ядерными и часто быстро разрушаются. Фактически, подклассы lncRNAs различаются разными путями распада, ответственными за их деградацию (Marquardt et al. 2011), которые часто становятся мишенями во время или вскоре после синтеза (Houseley and Tollervey 2009). Как класс, днРНК демонстрируют плохую консервацию последовательностей между видами. Однако отсутствие сходства последовательностей не обязательно исключает функцию, поскольку несколько функционально консервативных днРНК демонстрируют небольшую или не обнаруживаемую гомологию первичных последовательностей между близкородственными видами, как в случае специфичного для инактивации X транскрипта XIST, который отвечает за инициирование дозировки. компенсация у самок млекопитающих (Pang et al.2006 г.). Более того, некоторые промоторы днРНК, сайты сплайсинга и положения относительно фланкирующих генов сохраняются в процессе эволюции (Ulitsky 2016), что указывает на то, что транскрипция днРНК в эквивалентных положениях может быть сохранена, даже если это приводит к продуктам РНК, которые не имеют очевидной гомологии.

    Предполагаемые функции были возложены на постоянно увеличивающееся число днРНК с относительно высоким и низким содержанием в различных организмах [как подробно рассмотрено в Mercer et al. (2009), Понтинг и др.(2009), Ринн и Чанг (2012), Гейслер и Коллер (2013), Кунг и др. (2013), Engreitz et al. (2016), Куинн и Чанг (2016)]. Однако механизмы, с помощью которых специфические lncRNAs достигают своих эффектов на регуляцию генов, осложняются тем фактом, что транскрипция lncRNA может сама влиять на активность соседних генов (Kornienko et al. 2013). Это проблематично, поскольку экспериментально трудно отличить роли любой данной днРНК от неожиданных последствий, возникающих в результате акта ее транскрипции.Например, импринтированная днРНК Airn мыши первоначально была предложена для индукции направленной репрессии гена Igf2r путем опосредования образования петель хроматина, но более поздние анализы показали, что днРНК Airn сама по себе незаменима, поскольку акт транскрипции этого локуса достаточен для индукции сайленсинга Igf2r (Latos и др. 2012). Точно так же новые исследования lncRNA регулярно ставят под сомнение или даже опровергают интерпретации более ранних (Cech and Steitz 2014). Отчасти это связано с тем, что общепринятые методы четкого определения функции днРНК были разработаны и приняты только недавно (Bassett et al.2014; Гофф и Ринн 2015). В конечном итоге идея о том, что акт некодирующей транскрипции может сам по себе иметь важные функциональные результаты, представляет собой интригующую парадигму того, как широко распространенная транскрипция, даже когда такие действия не приводят к образованию стабильных днРНК («криптическая транскрипция»), может выполнять важные биологические роли как в плотных дрожжах. геномов, а также в гораздо более крупных геномах многоклеточных эукариот.

    Здесь мы обсуждаем недавно появившиеся особенности, которые отличают кодирующую транскрипцию от некодирующей у дрожжей и человека, и обрисовываем, как эти различия могут иметь важные последствия для функциональных последствий всеобъемлющей некодирующей транскрипции как проксимально, так и далеко от генов, кодирующих белок.

    Цикл транскрипции генов, кодирующих белок

    Транскрипция RNAPII тесно координируется с изменениями хроматина и процессингом зарождающейся РНК. Многие факторы, опосредующие эту котранскрипционную активность, нацелены на взаимодействие с формирующейся РНК (Bentley 2014; Battaglia et al.2017), посттрансляционные модификации гистонов (Jonkers and Lis 2015) и / или посттрансляционные модификации С-конца домен (CTD) наибольшей субъединицы RNAPII, который состоит из гептапептидных повторов (Y 1 S 2 P 3 T 4 S 5 P 6 S 7 ) (Corden 2013 ).Различные модификации CTD рекрутируют / отталкивают различные комплексы, обрабатывающие РНК и модифицирующие хроматин, и, следовательно, сопровождают разные стадии цикла транскрипции (рис. 1А). Напр., Ассоциированный с промотором RNAPII приобретает фосфорилирование Ser5 (Ser5P), которое рекрутирует Set1 для триметилирования гистона h4 лизина 4 (h4K4me3) на проксимальных к промотору нуклеосомах (Ng et al. 2003). h4K4me3, наряду с ацетилированием гистонов, являются определяющими характеристиками активных промоторов генов, кодирующих белок. Хорошо законсервированные гистоновые шапероны FACT и Spt6 путешествуют с RNAPII и способствуют транскрипции через хроматин (Kwak and Lis 2013).Поскольку транскрипция происходит от сайта инициации, Set1 ограничивает ацетилирование гистонов промотором путем депонирования h4K4me2, который создает платформу для комплекса гистондеацетилазы Set3 (HDAC) (Kim and Buratowski 2009). Удлинение RNAPII быстро теряет Ser5P, приобретает Ser2P и привлекает Set2 для депонирования h4K36me3, который необходим для стабилизации Rpd3S HDAC над телами активных генов (Li et al. 2003; Brodsky et al. 2005; Carrozza et al. 2005; Keogh et al. 2005; Дроуин и др. 2010; Говинд и др.2010). Клетки, лишенные этих факторов, имеют тенденцию накапливать lncRNAs, которые инициируются внутри или перекрываются и препятствуют экспрессии генов, кодирующих белок (Kaplan et al. 2003; Li et al. 2007; Cheung et al. 2008). В некоторых случаях альтернативные внутригенные промоторы могут также приводить к появлению альтернативных изоформ транскриптов, которые генерируют усеченные на N-конце белки с различными функциональными результатами (Wiesner et al. 2015). Таким образом, изменения хроматина, связанного с транскрипцией RNAPII, как подавляют альтернативные кодирующие изоформы транскриптов, так и предотвращают некодирующую инициацию транскрипции с «загадочных» внутригенных промоторов.Наконец, терминация транскрипции характеризуется Ser2P и Thr4P, которые помогают замедлять RNAPII и запускать расщепление растущего транскрипта / образование 3′-конца (Harlen and Churchman 2017). Этот последний шаг особенно важен, поскольку неэффективная терминация заставляет RNAPII не ослабевать и мешать экспрессии генов, расположенных ниже по течению (Proudfoot 1986), феномен, часто наблюдаемый в плотных геномах дрожжей (Gullerova and Proudfoot 2010). Кроме того, несанкционированные акты вмешательства в транскрипцию также наблюдались при различных заболеваниях человека (Proudfoot, 2016).Таким образом, всеобъемлющая транскрипция подразумевает, что большинство актов транскрипции, вероятно, нарушает активность других близко расположенных или перекрывающихся единиц транскрипции (Mellor et al., 2016), даже в геномах млекопитающих, которые показывают гораздо большее расстояние между генами.

    Рисунок 1

    Возникающие различия в поведении RNAPII в единицах кодирования белка и днРНК. (A) Цикл транскрипции RNAPII в генах, кодирующих белок, определяется четырьмя различными стадиями. Эти стадии характеризуются ассоциацией RNAPII с факторами элонгации транскрипции и факторами процессинга РНК, многие из которых рекрутируются посредством различных посттрансляционных модификаций CTD RNAPII и / или гистонов.Здесь перечислены только некоторые из этих факторов. Активные промоторы — это NDR, тогда как терминаторы обычно обогащены консенсусным мотивом AATAAAT. (B) В общем, днРНК гораздо менее многочисленны, чем мРНК, поскольку днРНК преимущественно локализованы в хроматине, где они быстро деградируют (Schlackow et al.2017). (C) Исследования метаболического мечения с использованием 4sU или 4tU показывают, что скорость транскрипции RNAPII в среднем ниже для lncRNA (Barrass et al. 2015; Eser et al. 2016; Mukherjee et al. 2017). (D) Многие днРНК также демонстрируют пониженные уровни связанных с транскрипцией гистоновых меток, таких как h4K4me3 и h4K36me3 (Sun et al.2015), снижение набора многих общих факторов удлинения (Battaglia et al., 2017; Fischl et al., 2017), неэффективная обработка (Eser et al., 2016; Mukherjee et al., 2017; Schlackow et al., 2017) и раннее прекращение ( Миллиган и др., 2016; Шлаков и др., 2017). 4sU, 4-тиоуридин; 4tU, 4-тиоурацил; CTD, С-концевой домен; h4K, гистон h4 лизин; днРНК, длинная некодирующая РНК; NDR — области с истощенными нуклеосомами; RNAPII, РНК-полимераза II.

    Различное поведение RNAPII в отношении кодирующих и некодирующих единиц транскрипции

    В многоклеточных организмах тканеспецифическая экспрессия днРНК и методы, основанные на установившихся уровнях РНК [e.g., секвенирование общей РНК (RNA-seq)] может привести к заниженным оценкам численности днРНК из-за недостаточной выборки днРНК в сложных смесях (Deveson et al., 2017). Многие днРНК не обнаруживаются, поскольку транскрипция RNAPII поверх некодирующей ДНК часто не дает стабильных РНК. Ранее эти криптические lncRNAs наблюдались только в клетках, лишенных факторов контроля качества / распада РНК (Jensen et al. 2013), подразумевая, что они быстро нацелены на деградацию и могут просто аберрантно продуцироваться.Однако появляется все больше свидетельств того, что транскрипция как стабильных, так и криптических днРНК может быть чувствительной к сигналам окружающей среды и, следовательно, динамически регулировать экспрессию соседних генов (описанных ниже). Разработка менее интрузивных методов профилирования зарождающейся транскрипции в клетках дикого типа теперь позволяет аннотировать и характеризовать ранее необнаруженные криптические единицы транскрипции во всех геномах.

    Один из этих менее разрушительных методов профилирования зарождающейся транскрипции включает быстрое мечение растущей РНК путем воздействия на клетки 4-тиоурацила (4tU) или 4-тиоуридина (4sU).После выделения из клеток меченую РНК затем обогащают от общей РНК, секвенируют и сравнивают с данными RNA-seq в стационарном состоянии для расчета скорости синтеза и деградации РНК. Этот подход недавно показал, что кодирующие и некодирующие единицы транскрипции обнаруживают различные паттерны синтеза и деградации. В целом днРНК дрожжей и человека транскрибируются медленнее и деградируют быстрее, чем мРНК (Barrass et al. 2015; Eser et al. 2016; Mukherjee et al. 2017), что соответствует их более низким общим уровням (рис. 1, B и C).Хотя есть данные, позволяющие предположить, что сайты сплайсинга днРНК являются консервативными (Haerty and Ponting 2015; Nitsche et al.2015), анализ 4tU- / 4sU-секвенирования (-seq) демонстрирует, что большинство днРНК человека и дрожжей сплайсируются слабо (Eser et al. др., 2016; Мукерджи и др., 2017). В целом транскрипция и процессинг днРНК в среднем намного менее эффективны, чем мРНК.

    Зарождающаяся транскрипция также была профилирована путем секвенирования RNAPII-ассоциированных РНК. Захватывая нативные комплексы RNAPII-ДНК-РНК из хроматина и секвенируя, 3′-самый нуклеотид RNAPII-ассоциированных РНК, NET-seq (секвенирование нативного удлиняющего транскрипта) визуализирует активную транскрипцию при разрешении одного нуклеотида (Churchman and Weissman 2011).Этот метод использовался для профилирования зарождающейся транскрипции у различных видов дрожжей и мутантов (Churchman and Weissman 2011; Marquardt et al. 2014; Nguyen et al. 2014; Fischl et al. 2017; Shetty et al. 2017) и недавно был адаптирован. для клеток человека (Нодзима и др., 2015; Фонг и др., 2017). Данные, полученные с помощью связанных методов, которые основаны на УФ-перекрестном связывании RNAPII с образующейся РНК (например, перекрестное связывание и анализ кДНК, иначе известный как CRAC) или анализ ядерных циклов по всему геному [например, глобальное или точное последовательное секвенирование (GRO-seq или PRO-seq)] сильно коррелируют с наборами данных NET-seq (Mahat et al.2016; Миллиган и др. 2016; Nojima et al. 2016). Следовательно, хотя каждый метод имеет разные ограничения и применимость, все они обеспечивают относительно точное описание зарождающейся транскрипции в геномах.

    Как в Saccharomyces cerevisiae, так и в клетках человека, различные паттерны поведения между генными и межгенными циклами транскрипции днРНК также возникают из исследований с использованием NET-seq или CRAC для картирования специфических модификаций RNAPII CTD. Примечательно, что транскрипция днРНК нечасто переходит от стадии инициации к фазе элонгации и, когда это происходит, в значительной степени демонстрирует раннюю терминацию (Milligan et al.2016; Schlackow et al. 2017). Например, сильные пики CTD-Thr4P наблюдаются почти исключительно в сайтах терминации транскрипции для генов, кодирующих белок человека, в то время как эта специфическая для терминации модификация обогащена во всех межгенных единицах транскрипции днРНК (Schlackow et al.2017) (Рисунок 1D). Schlackow et al. (2017) также сравнили профили РНК-seq для транскриптов, выделенных из различных субядерных компартментов (например, обогащенных хроматином и обогащенной нуклеоплазмой), и обнаружили, что днРНК неэффективно сплайсируются, нечасто полиаденилируются и обогащаются хроматином, где они нацелены на опосредованные экзосомами деградация.Эти данные подтверждают наблюдаемые различия в процессинге и стабильности lncRNA из кинетических исследований с использованием 4tU- или 4sU-seq.

    Дифференциальное привлечение факторов элонгации к RNAPII во время кодирующей и некодирующей транскрипции

    Положения RNAPII-ассоциированных факторов, задействованных во время зарождающейся транскрипции, а также взаимодействия многих из этих факторов с возникающими РНК, недавно были профилированы по всему геному. Например, NET-seq в S. cerevisiae адаптирован для захвата факторов элонгации в комплексе с RNAPII-ассоциированными РНК для визуализации положения таких факторов во время транскрипции (Fischl et al.2017). Эти анализы демонстрируют, что специфичный для терминации фактор Pcf11 обогащается RNAPII во время транскрипции lncRNA, тогда как многие общие факторы элонгации (включая Paf1, Set2, FACT и Spt6) в среднем обнаруживают пониженное рекрутирование (Figure 1D). Хотя в настоящее время неясно, что определяет эти различия, недавние открытия предполагают, что многие факторы элонгации в S. cerevisiae частично рекрутируются в RNAPII посредством относительно неспецифических прямых взаимодействий с формирующейся РНК и что они демонстрируют гораздо большее сродство к мРНК по сравнению с днРНК (Battaglia et al.2017). Эти результаты подразумевают, что стабильные кодирующие транскрипты непропорционально рекрутируют факторы элонгации, необходимые для продуктивной транскрипции RNAPII, поскольку целенаправленная ассоциация факторов наблюдения РНК со специфическими мотивами в lncRNAs может физически блокировать связывание факторов элонгации. Важно отметить, что эти находки согласуются с вышеупомянутыми анализами, показывающими плохую процессивность, неэффективный процессинг и раннюю терминацию RNAPII во время транскрипции lncRNA.

    lncRNA-Specific Chromatin Features

    Различия в привлечении основных факторов элонгации к RNAPII во время некодирующей транскрипции объясняют уникальные сигнатуры хроматина, обнаруженные во многих локусах lncRNA (Figure 2).Напр., Многие днРНК человека обнаруживают сниженные уровни общих транскрипционно-связанных модификаций гистонов, таких как h4K4me3 и h4K36me3 (Sun et al. 2015). Кроме того, активные промоторы днРНК человека, по-видимому, обогащены h4K9me3 (Méle et al., 2017), модификацией, обычно связанной с гетерохроматином и подавлением генов. У S. cerevisiae антисмысловая транскрипция днРНК генам, кодирующим белок, характеризуется значительно более высокими уровнями ацетилирования h4 и сниженным уровнем h4K36me3 (Murray et al.2015). Внутри транскрибируемых областей центромер у высших эукариот нуклеосомы, содержащие канонический h4, истощены по меткам, характерным для активных промоторов, и вместо этого обогащены h4K4me1 / 2 и h4K36me2 / 3 (Sullivan and Karpen 2004; Bergmann et al. 2011). Некодирующая транскрипция на активных энхансерных элементах у многоклеточных также совпадает с отсутствием многих активных промоторных меток, вместо этого демонстрируя высокие уровни h4K4me1 (Li et al. 2016). В совокупности эти находки предоставляют убедительные доказательства, отличающие ассоциированные с транскрипцией сигнатуры хроматина для генов, кодирующих белок, от сигнатур появляющихся подклассов некодирующих единиц транскрипции RNAPII.

    Рисунок 2

    Хроматиновые сигнатуры кодирующей и некодирующей транскрипции. (A) Распределение модификаций гистонов, связанных с транскрипцией, по активным генам, кодирующим белок. h4K4me3 и ацетилирование h4 по K9 и K27 обогащено на промоторах, тогда как h4K4me2 и h4K36me3 накапливаются по телам генов (Corden 2013). (B) Межгенные днРНК в среднем демонстрируют пониженные уровни h4K4me3 и h4K36me3 (Sun et al., 2015) и демонстрируют преждевременную терминацию и дефектный процессинг возникающих транскриптов (Schlackow et al.2017). h4K9me3, метка, обычно характерная для репрессивного гетерохроматина, была обнаружена на активных промоторах днРНК в клетках человека (Méle et al. 2017). Важно отметить, что некоторые единицы транскрипции днРНК также имеют больше мРНК-подобных паттернов CTD и модификаций гистонов. (C) Хроматиновые метки, обычно связанные с активными промоторами (h4K4me3 и ацетилирование h4), истощены из некодирующих единиц транскрипции в энхансерных элементах у высших эукариот. Вместо этого энхансеры обогащены h4K4me1 (Li et al.2016). (D) антисмысловая транскрипция lncRNA по отношению к кодирующим белок генам, как было обнаружено, соответствует уменьшенному h4K36me3 и другим меткам, обычно связанным с активным удлинением транскрипции и вместо этого обогащенным для ацетилирования h4 (Murray et al. 2015). (E) Некодирующая транскрипция в центромерах соответствует отсутствию ацетилирования h4K4me3 и h4. Вместо этого центромерные нуклеосомы, содержащие канонический h4, обогащены h4K4me1 / 2 и h4K36me2 / 3 (Sullivan and Karpen 2004; Bergmann et al.2011). Частая остановка транскрипции в центромерах делящихся дрожжей, как было обнаружено, также стимулирует включение нуклеосом, содержащих h4-вариант CENP-A, который эпигенетически определяет центромеры (Catania et al. 2015). CENP-A, центромерный белок-A; CTD, С-концевой домен; h4K, гистон h4 лизин; днРНК, длинная некодирующая РНК; RNAPII, РНК-полимераза II.

    Дивергентные кодирующие / некодирующие промоторы предоставляют уникальную возможность для сравнения циклов транскрипции RNAPII в парах lncRNA / mRNA

    Профилирование зарождающейся транскрипции было особенно информативным в демонстрации того, что большинство областей с истощенными нуклеосомами инициируют транскрипцию в обоих направлениях (Wei et al.2011; Scruggs et al. 2015) (рисунок 3). Анализ экспрессии генов методом кэп-анализа (CAGE) демонстрирует, что циклы транскрипции в обоих направлениях начинаются с обеспечения одной и той же модификации 5′-кэпа первого транскрибированного основания (Andersson et al. 2014). Однако дивергентные lncRNAs часто становятся мишенью для опосредованной экзосомами деградации (Preker et al. 2008), при этом мРНК смысловой цепи заметно более стабильна. Это справедливо даже для расходящихся пар днРНК / мРНК, которые показывают сходные уровни зарождающейся транскрипции (Sigova et al.2013). Таким образом, большинство промоторов, по-видимому, предпочтительно управляют транскрипцией в направлении кодирования. Механизм (ы), с помощью которого достигается направленность, не совсем понятен. Последовательности расщепления канонических транскриптов, полиаденилирования и терминации обогащены некоторыми дивергентными lncRNAs (Almada et al. 2013). Интересно, что в то время как эти цис-элементы ДНК приводят к образованию стабильной мРНК в кодирующем направлении, дивергентная терминация днРНК запускает опосредованную экзосомами деградацию днРНК (Ntini et al.2013). Различные эффекты цис-элементов расщепления и полиаденилирования на мРНК и днРНК согласовывают различия в стабильности пар транскриптов от таких промоторов. Кроме того, сила транскрипции в любом направлении выборочно регулируется на уровне хроматина, поскольку дивергентная транскрипция днРНК может подавляться или активироваться рядом факторов ремоделирования хроматина (Churchman and Weissman 2011; Marquardt et al. 2014; Scruggs et al.2015). ). Факторы, связанные с RNAPII, такие как PAFI, DSIF и Ssu72, также участвуют в контроле направленности (Tan-Wong et al.2012; Fischl et al. 2017; Shetty et al. 2017). Интересно, что есть данные, позволяющие предположить, что RNAPII CTD обогащен для фосфорилирования Tyr1 во время дивергентной некодирующей транскрипции (Descostes et al. 2014; Hsin et al. 2014), что дополнительно раскрывает уникальные свойства транскрипции lncRNA. Хотя транскрипция из кодирующих / некодирующих пар жестко контролируется, наше понимание того, как RNAPII, RNAPII-ассоциированные факторы и ремоделеры хроматина различают кодирующие и некодирующие ориентации, является рудиментарным.Более того, цель некодирующей транскрипции с двунаправленных промоторов остается малоизученной. Учитывая, что широко распространенная дивергентная некодирующая транскрипция обнаруживается у многих организмов, это может оказаться неизбежным следствием структуры эукариотического промотора. Однако идентификация факторов, необходимых для специфической активации или репрессии дивергентной транскрипции lncRNA, демонстрирует жесткую регуляцию этого процесса, что указывает на функциональную значимость, хотя это значение еще не полностью объяснено.

    Рисунок 3

    Двунаправленные промоторы. Хотя большинство промоторов могут инициировать транскрипцию в любом направлении, обычно предпочтительна смысловая ориентация. Некоторые факторы, связанные с RNAPII, и изменения хроматина, по-видимому, контролируют направленность. Напр., PAF1, DSIF и Ssu72, по-видимому, стимулируют транскрипцию RNAPII в смысловом направлении (Tan-Wong et al. 2012; Fischl et al. 2017; Shetty et al. 2017). Ремоделеры хроматина также конкурируют за регулирование дивергентной транскрипции. Примечательно, что CAF-I подавляет дивергентную транскрипцию, способствуя включению нуклеосом с h4K56ac, тогда как комплекс SWI / SNF противодействует этой активности и тем самым способствует дивергентной транскрипции (Marquardt et al.2014). Дивергентная транскрипция RNAPII также может быть обогащена Tyr1P (Y1P) (Descostes et al. 2014; Hsin et al. 2014). Наконец, многие дивергентные lncRNAs обогащены проксимальными к промоторам сайтами полиаденилирования и нацелены на раннюю терминацию и опосредуемую экзосомами деградацию в ядре (Preker et al. 2008; Almada et al. 2013; Ntini et al. 2013). Напротив, стабильные зрелые мРНК транспортируются в цитоплазму для синтеза белка. h4, гистон h4; днРНК, длинная некодирующая РНК; поли- (A) сайт (PAS),; RNAPII, РНК-полимераза II; переключатель / сахароза неферментируемая (SWI / SNF).

    Функциональные днРНК проявляют мРНК-подобные транскрипционные свойства

    Как и ожидалось, существуют исключения из доминантных паттернов, выделенных выше. Анализ зарождающейся транскрипции также выявил днРНК, которые проявляют более мРНК-подобные транскрипционные свойства (см. Рисунок 2B). Например, два таких транскрипта, обнаруженные в клетках HeLa человека, включают широко распространенные транскрипты NORAD и TINCR (Schlackow et al., 2017). NORAD локализуется в цитоплазме, где он контролирует экспрессию генов, взаимодействуя и регулируя РНК-связывающие белки Pumilio (Lee et al.2016), тогда как TINCR поддерживает дифференцировку соматических клеток за счет взаимодействия и стабилизации специфичных для дифференцировки мРНК (Kretz et al. 2013). Поскольку днРНК обычно демонстрируют более сильные тканеспецифические паттерны экспрессии, чем гены, кодирующие белок (Derrien et al. 2012; Kornienko et al. 2016), анализ возникающих транскриптов необходимо расширить на другие типы клеток человека, чтобы идентифицировать больше мРНК-подобных днРНК, поскольку этот подкласс с большой вероятностью будет иметь конкретные и заметные функции.

    Регуляция гена с помощью Закона о транскрипции

    Различия в кодирующей и некодирующей транскрипции, которые были выделены выше, позволяют предположить, что транскрипция днРНК является почти исключительно скрытой.Даже некоторые из наиболее распространенных lncRNA человека преимущественно ограничены хроматином, где они быстро деградируют (Schlackow et al.2017). В целом, открытия различных эукариотических систем предполагают роль некодирующих последовательностей ДНК помимо продуцируемых относительно короткоживущих криптических днРНК. Идея о том, что акт некодирующей транскрипции может иметь функциональные последствия, подтверждается растущим числом межгенных lncRNAs, транскрипция которых регулирует близлежащие гены.

    Наиболее хорошо охарактеризованный пример регуляции соседнего гена посредством некодирующей транскрипции RNAPII включает S.cerevisiae SER3 (кодирующий 3-фосфоглицератдегидрогеназу). SER3 репрессируется транскрипцией днРНК SRG1, инициируя ~ 500 п.н. выше промотора SER3, когда клетки растут в присутствии серина (Martens et al. 2004). Следовательно, снижение транскрипции SRG1 после серинового голодания делает возможным индукцию SER3 (Martens et al. 2005). МРНК SER3 также накапливается в клетках, выращиваемых в условиях избыточного количества серина после разрушения многочисленных факторов элонгации транскрипции, которые, как известно, участвуют в связанных с транскрипцией изменениях хроматина (например,g., Spt6, FACT и Paf1), хотя SRG1 все еще экспрессируется у этих мутантов (Hainer et al. 2011; Pruneski et al. 2011). Примечательно, что опосредованная транскрипцией регуляция SER3 происходит как Set1-, так и Set2-независимым образом (Hainer et al. 2011), указывая тем самым, что метилирование h4K4 и h4K36 не играет значительной роли в этом механизме. Напротив, ключевые остатки гистонов h4 и h5 необходимы для восходящей транскрипции lncRNA, чтобы обеспечить повышенную плотность нуклеосом по сравнению с промотором SER3 (Hainer and Martens 2011), но точная роль этих остатков гистона все еще неясна.В совокупности эти анализы показали, что SER3 репрессируется актом восходящей транскрипции, которая опосредует специфические связанные с транскрипцией изменения хроматина через промотор SER3 в процессе, называемом «транскрипционная интерференция».

    О других актах опосредованной транскрипцией регуляции генов также сообщалось у S. cerevisiae и в других системах. У S. cerevisiae вышестоящая транскрипция днРНК репрессирует ген IME1, индуцирующий мейоз, и тем самым регулирует половую дифференциацию (van Werven et al.2012), тогда как межклеточная адгезия частично контролируется транскрипцией lncRNA выше гена FLO11 (Bumgarner et al. 2009). У делящихся дрожжей Schizosaccharomyces pombe гомеостаз питательных веществ контролируется опосредованной транскрипцией днРНК регуляцией множества генов, включая fbp1 + , pho1 + и tgp1 + (Hirota et al., 2008; Ard et al., 2014). ; Ард и Оллшир, 2016). Связанные с этим примеры регуляции генов посредством смежных актов транскрипции также были описаны в клетках плодовых мушек, мышей и человека (Corbin and Maniatis 1989; Bird et al.2006; Петрук и др. 2006; Abarrategui and Krangel 2007; Мартьянов и др. 2007). Кроме того, аберрантная опосредованная транскрипцией репрессия генов наблюдалась при заболеваниях человека (De Gobbi et al. 2006; Grosso et al. 2015; Rutkowski et al. 2015). Было также высказано предположение, что некоторые виды рака могут быть инициированы реактивированными ретротранспозонами, транскрипция которых подавляет экспрессию соседних генов (Wilkins 2010). Сходным образом, транскрипция RNAPII, инициируемая внутри межгенной вставки Т-ДНК, как было обнаружено, перекрывает и репрессирует нижележащий ген у Arabidopsis thaliana (Hedtke and Grimm 2009), демонстрируя, что этот механизм, вероятно, также будет функционально консервативным у растений.Вместе эти примеры подчеркивают, что регуляция генов посредством перекрывающейся транскрипции широко консервативна, не ограничивается строго канонической транскрипцией днРНК и может иметь важные последствия для здоровья и болезней человека.

    Разнообразные механизмы регуляции генов посредством акта транскрипции

    Некодирующая транскрипция рядом с генами, кодирующими белок или перекрывающими их, может иметь различные локус-специфичные результаты (Mellor et al. 2016). В большинстве случаев тандемная транскрипция в нижележащий промотор приводит к репрессии гена за счет транскрипционной интерференции (Proudfoot 1986).Анализ с высоким разрешением изолированной хроматином РНК показывает, что связывание факторов транскрипции вызывает сильную паузу RNAPII в клетках человека (Mayer et al. 2015), что противоречит модели, согласно которой репрессия генов, опосредованная транскрипцией, просто включает вытеснение нижестоящих факторов транскрипции. Как видно из регуляции гена SER3 посредством транскрипции днРНК SRG1, связанные с транскрипцией изменения хроматина, опосредованные рекрутируемыми RNAPII факторами, по крайней мере частично, способствуют репрессии промоторов генов, вмешиваясь в днРНК в различных системах (Petruk et al.2006; van Werven et al. 2012; Ард и Оллшир, 2016 год; Kim et al. 2016). Таким образом, такие активности ремоделирования хроматина задействуются RNAPII во время этих актов транскрипции в достаточных количествах для подавления активности основного промотора. Кроме того, эти данные предполагают, что факторы, участвующие в подавлении скрытых внутригенных промоторов во время синтеза мРНК, также репрессируют промоторы генов посредством транскрипционной интерференции. Однако во многих изученных случаях конкретные факторы различаются (рис. 4).Некоторые из этих различий, вероятно, связаны с длиной и / или другими свойствами, специфичными для отдельных актов транскрипции днРНК. Например, сокращение расстояния между мешающей единицей транскрипции и ее целевым промотором снижает потребность в Set2-опосредованной репрессии с помощью h4K36me3 (Kim et al., 2016), что согласуется с наблюдением, что Set2 рекрутируется во время элонгации транскрипции и преимущественно подавляет криптические промоторы в направлении 3′-конец более длинных генов дрожжей (Li et al.2007). Более того, Set2 заглушает промоторы генов, закрытые более длинными, но не более короткими интерферирующими lncRNAs (Hainer et al. 2011; van Werven et al. 2012; Ard and Allshire 2016). Напротив, в некоторых случаях восходящая транскрипция также может положительно влиять на экспрессию нижележащих генов. Примечательно, что каскадная транскрипция множества днРНК в промотор гена fbp1 + S. pombe требуется для замещения связанных с промотором репрессоров транскрипции и активации экспрессии генов (Takemata et al.2016). Сходным образом у Drosophila сообщалось, что межгенная транскрипция стимулирует активацию соседних генов за счет смещения репрессивных модифицирующих комплексов хроматина (Schmitt et al. 2005). Интересная возможность заключается в том, что снижение привлечения определенных факторов к RNAPII в определенных некодирующих единицах транскрипции [как было предложено Fischl et al. (2017) и Battaglia et al. (2017)] может предотвратить в противном случае репрессивные эффекты на основной промотор. Очевидно, что необходимо всестороннее понимание механизмов, чтобы определить, как одни акты транскрипции днРНК приводят к активации генов, тогда как другие подавляют экспрессию.

    Рисунок 4

    Отдельные механизмы регуляции генов, опосредованной транскрипцией днРНК. (A) Сериновое голодание индуцирует экспрессию SER3 в S. cerevisiae. В присутствии серина SER3 репрессируется транскрипцией днРНК SRG1, которая инициируется с промотора, расположенного примерно на 0,5 т.п.н. выше сайта начала транскрипции SER3 (Martens et al. 2004, 2005). Репрессия в этом случае требует котранскрипционных изменений положений нуклеосом над промотором SER3, опосредованных гистоновыми шаперонами FACT и Spt6 (Hainer et al.2011). Эффективная SRG1-обеспечиваемая репрессия SER3 также нуждается в комплексе PAF1 (Pruneski et al. 2011). SRG1 слишком короткий для элонгации транскрипции, чтобы депонировать значительные уровни h4K4me2 или h4K36me3, что объясняет, почему Set1 и Set2 не требуются для регуляции экспрессии SER3 (Hainer et al. 2011). Напротив, другие менее охарактеризованные остатки гистонового хвоста участвуют в репрессии SER3 с помощью SRG1 (например, h4V46, h4R49, h4V117, h4Q120, h4K122, h5R36, h5I46 и h5S47) (Hainer and Martens 2011) (B) В S.pombe, криптическая lncRNA nc-tgp1 размером 2 т.п.н. репрессирует ген tgp1 + в ответ на доступность фосфата (Ard et al. 2014). FACT и Spt6, наряду с Set2 и Clr6 Rpd3S , все частично вносят вклад в подавление tgp1 + с помощью транскрипции nc-tgp1 (Ard and Allshire 2016). Роль комплекса PAF1 в регуляции tgp1 + еще предстоит изучить. Сообщалось о связанных механизмах опосредованной днРНК репрессии гена pho1 + у S. pombe (Ard and Allshire, 2016) и гена IME1 у S.cerevisiae (ван Вервен и др., 2012). (C) Ген fbp1 + S. pombe репрессируется, когда клетки растут в присутствии глюкозы. В отличие от примеров, описанных в (A и B), экспрессия fbp1 + после голодания по глюкозе стимулируется транскрипцией множественных вышестоящих lncRNAs (Hirota et al. 2008). Хотя считается, что акт транскрипции помогает вытеснить репрессоры транскрипции Tup11 и Tup12 (Takemata et al. 2016), неясно, почему изменения котранскрипционного хроматина не репрессируют промотор fbp1 + .В будущих исследованиях стоит изучить вопрос о том, помогают ли различия в привлечении факторов элонгации к RNAPII во время некоторых актов некодирующей транскрипции (Battaglia et al., 2017; Fischl et al., 2017) для объяснения механистических различий. FACT, облегчает транскрипцию хроматина; h4, гистон h4; днРНК, длинная некодирующая РНК; RNAPII, РНК-полимераза II.

    Выявление механизмов и масштабов функциональной некодирующей транскрипции

    Для лучшего понимания механизмов и масштабов функциональной некодирующей транскрипции потребуется сочетание классических генетических подходов и передовой геномики.Транскрипция RNAPII, происходящая из преднамеренных мутагенов в S. cerevisiae, таких как элементы Ty, привела к оригинальной характеристике опосредованной транскрипцией репрессии генов и изоляции мутантов-супрессоров (Winston et al. 1984). В самом деле, именно так изначально был идентифицирован гистоновый шаперон Spt6 (супрессор Ty 6). Учитывая накапливающееся количество примеров регуляции транскрипции генов у высших эукариот, прямой генетический скрининг будет особенно полезен для лучшего понимания разнообразия механизмов, действующих в многоклеточных организмах.Такие подходы оказываются намного менее сложными с появлением эффективных сгруппированных с регулярными интервалами коротких палиндромных повторов (CRISPR) -Cas9-опосредованных скринингов всего генома в человеческих клетках (Shalem et al. 2014; Wang et al. 2014). ВНИМАНИЕ !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Дополнительные преимущества могут быть получены при использовании полностью гаплоидной клеточной линии (Blomen et al. 2015). Обратный генетический скрининг, основанный на исследованиях на дрожжах, будет столь же информативным для проверки сохранения механизмов, описанных выше. Кроме того, совмещение данных о зарождающемся транскриптоме с геномными положениями факторов, связанных с RNAPII, и модификациями гистонов даст важные ключи к разгадке характеристик хроматина и транскрипции, которые являются уникальными для регуляции генов посредством актов транскрипции, и должно помочь в идентификации новых примеров транскрипции -опосредованная регуляция генов.В частности, TIF-seq (секвенирование изоформ транскрипта) последовательности сайтов начала / конца транскрипции одновременно и, следовательно, могут отличать измененные изоформы транскрипта от вышележащих lncRNA или сквозных транскриптов, которые перекрываются нижележащими промоторами (Pelechano et al. 2013). Перекрывающиеся транскрипты, в частности, недостаточно представлены в обычных наборах данных по полной последовательности РНК и возникающих транскриптомах, поскольку эти методы не позволяют точно предсказать сайты начала / остановки транскрипции. Таким образом, TIF-seq является полезным и дополнительным методом, позволяющим лучше охарактеризовать распространенность потенциально мешающих днРНК и идентифицировать гены с изоформами днРНК, транскрипция и / или продукты которых могут иметь функциональное значение для их регуляции.Сравнение данных, полученных с помощью этих различных подходов, будет полезным для понимания разнообразия молекулярных механизмов, участвующих в регуляции генов посредством самой транскрипции, а также степени, в которой всеобъемлющая транскрипция способствует тонкой настройке экспрессии генов в геномах.

    Функциональные последствия транскрипции за пределами местной регуляции генов

    Помимо освещения того, как регулируются близлежащие гены, новые геномные подходы также будут идентифицировать некодирующие события транскрипции дальше от белков, кодирующих гены, которые все еще могут быть функционально значимыми, например, вовлеченные в более крупные изменения в структуре и организации хроматина / хромосомы.Например, акт постоянной инициации и приостановки транскрипции RNAPII в центромерах S. pombe вовлечен в изменения хроматина, которые способствуют включению центромеры-специфического h4-варианта центромерного белка-A (Catania et al. 2015) (см. Рисунок 2E). . Такой механизм может быть широко консервативным, учитывая, что центромерная транскрипция была обнаружена у организмов от S. cerevisiae до растений и животных (Scott 2013). Кроме того, было высказано предположение, что акт транскрипции на энхансерах помогает ремоделировать структуру хроматина таким образом, чтобы опосредовать контакт с их промоторами-мишенями (Li et al.2016). Фактически, процесс как кодирующей, так и некодирующей транскрипции может приводить к изменениям в трехмерной структуре хроматина, включая взаимодействия хроматина более высокого порядка и субядерную локализацию специфических областей хроматина (Melé and Rinn 2016). Следовательно, всеобъемлющая транскрипция может играть центральную роль не только в регуляции конкретных генов и эпигенетических процессов, но также в пространственной и структурной организации хромосом внутри ядра.

    Заключительные мысли

    Недавние успехи в профилировании зарождающихся транскриптомов выявили множество различных паттернов поведения RNAPII в различных кодирующих и некодирующих областях генома.Хотя сами по себе эти различия недостаточны, чтобы решить, является ли какая-либо данная некодирующая единица транскрипции функционально релевантной или просто несущественным «транскрипционным шумом», появляются важные подсказки, помогающие категоризации.

    Примечательно, что геномы эукариот демонстрируют доказательства широко распространенной низкокачественной некодирующей транскрипции с помощью RNAPII. Следовательно, стабильный синтез РНК преимущественно ограничен генами, кодирующими белок, и подмножеством днРНК, проявляющих сходные «мРНК-подобные» свойства и / или поведение, связанное с RNAPII.Дополнительные подходы одновременно выявили общие различия между кодирующими и некодирующими циклами транскрипции, а также позволили различать уникальное поведение RNAPII отдельных типов некодирующих единиц транскрипции. Следовательно, разумно предположить, что подклассы lncRNAs можно различать на основании свойств их транскрипции, поскольку наблюдаемые различия в поведении RNAPII и статусе хроматина, вероятно, объясняют противоположные стабильности РНК и функциональные результаты.Например, помогает отличить функциональные продукты днРНК от функциональных актов некодирующей транскрипции, хотя такие различия не могут быть абсолютными.

    В настоящее время неясно, что определяет наблюдаемые различия в поведении RNAPII в любой данной единице транскрипции. Длина транскрипта, вторичная структура РНК и специфические мотивы последовательности ДНК или РНК могут влиять на транскрипцию RNAPII и, следовательно, вероятно, по крайней мере, частично способствуют наблюдаемым различиям в поведении RNAPII (Barrass et al.2015; Eser et al. 2016; Schwalb et al. 2016). Остается неясным, являются ли эти различия причиной или следствием пониженного рекрутирования специфических факторов на RNAPII во время некоторых актов некодирующей транскрипции. Важно отметить, что дифференциальное рекрутирование факторов элонгации RNAPII во время кодирования по сравнению с транскрипцией днРНК наблюдалось с помощью метагеновых анализов (Battaglia et al., 2017; Fischl et al., 2017), однако для репрессии генов посредством транскрипционной интерференции требуются многие факторы удлинения ядра (Hainer et al.2011; van Werven et al. 2012; Ард и Оллшир 2016). Возникает соблазн предположить, что выбранные единицы транскрипции lncRNA с нехарактерно высокой нагрузкой фактора элонгации RNAPII могут точно определять события транскрипции, влияющие на близлежащую экспрессию посредством репрессии генов, опосредованной транскрипцией lncRNA. Сходным образом, единицы транскрипции lncRNA, лишенные общих факторов, связанных с RNAPII, могут демонстрировать др. Особенности транскрипции и / или сигнатуры хроматина, которые опосредуют разные исходы.

    Требуются дальнейшие исследования, чтобы определить, в какой степени модификации гистонов, уникальные для некодирующих областей генома, влияют на наблюдаемые различия в транскрипции или преимущественно обусловлены свойствами RNAPII, уникальными для разных типов некодирующей транскрипции.В конечном счете, посттрансляционные модификации гистонов могут обеспечивать сохранение состояний хроматина над транскрибируемой некодирующей ДНК посредством эпигенетических процессов. Такой механизм будет сохранять не только эпигенетическую память о недавней транскрипционной активности, но также информацию о недавнем поведении транскрипции и, следовательно, имеет важные функциональные последствия для быстрых переключений в регулируемой некодирующей транскрипции.

    В итоге, факторы элонгации и ремоделеры хроматина участвуют в благоприятствовании продуктивной транскрипции RNAPII настолько, насколько они действуют, ограничивая аберрантную некодирующую транскрипцию, которая может мешать экспрессии генов.Хотя многие из этих факторов также вносят вклад в регуляцию экспрессии генов посредством актов транскрипции lncRNA, необходимы дальнейшие исследования, чтобы определить, что лежит в основе разнообразия механизмов, с помощью которых некодирующая транскрипция является функционально значимой.